We narrowed to 7,865 results for: 11
-
Plasmid#50451Purposeactivates p38 in the signaling pathwayDepositorInsertMKK3b (MAP2K3 Human)
TagsGstExpressionMammalianMutationchanged Serine 218 to Glutamic Acid, changed Thre…PromoterSV40Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
1287 p3E-mut let-7 etv2 3’ UTR
Plasmid#49011PurposeZebrafish Long length etv2 3' UTR with five let7 binding site mutations in gateway 3' Entry vectorDepositorInsertets variant gene 2 (etsrp Zebrafish)
UseGateway 3' entryMutationMutated the Let7 miRNA binding sitesAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
pRLCon1288-1666
Plasmid#31448DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRLCon183-221_850-1207
Plasmid#31449DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRLCon183-221mut2_850-1207
Plasmid#31450DepositorInsertHNF4A 3'UTR fragments (HNF4A Human)
UseLuciferaseExpressionMammalianMutationmut2 in balancerAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRLCon1-449_850-1207
Plasmid#31451DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2 xWnt11
Plasmid#24973DepositorInsertWnt11 (wnt11 Frog)
ExpressionMammalianAvailable SinceJune 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAL119-TK
Plasmid#21911DepositorInsertHSV Type 1 thymidine kinase
UseAdenoviralAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEVOL_PylRS(WT)-tRNA
Plasmid#223512PurposePylRS (WT)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialPromoteraraBAD, rrnB, and glnS and proKAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-polyQ23-NLS
Plasmid#231891PurposeExpression of non-aggregated HTT partial exon 1 Q23-NLS in the nucleusDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mRuby2
Plasmid#175294PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mRuby2
TagsmRuby2ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits