We narrowed to 1,065 results for: control gRNA
-
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertUseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNASAM(gEmpty)-TREGFP-PGKpuroBFP-W
Plasmid#112926PurposeCRISPR-a reporter assay lentiviral vector (empty gRNA control)DepositorInserthU6-gRNASAM(empty), TREGFP, PGKpuroGFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_EBFP_to_EGFP_Dual_pegRNA
Plasmid#178100PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and EBFP_To_EGFP pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–EgRNA
Plasmid#62716PurposeEmpty; no U6 gRNA cassetteDepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA3
Plasmid#164929PurposeExpresses Non-targeting sgRNA3 control in mammalian cellsDepositorInsertNon-targeting sgRNA3 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_1
Plasmid#73525PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
ptreCas9-mKate2ps-T1gRNA
Plasmid#62715PurposeInducible; gRNA seq is ATGAGAATCAAGGCGGTCGADepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK-puromycin-AflII
Plasmid#106404PurposeEmpty guide RNA cloning vector with an AflII site added from Addgene 41824DepositorTypeEmpty backboneExpressionMammalianPromoterU6Available SinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8 (ANV)
Plasmid#71829PurposeExpression of mutant dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-PuroR and specific sgRNA for the human BACH2 promoter; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 Human, Synthetic, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA[DsxF].1026A
Plasmid#112690Purposeexpress gRNA targeting DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA2
Plasmid#134636Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA2 (UFL1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA1
Plasmid#113130PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterU6 for gRNA expression, RSV for GFP expressionAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only