We narrowed to 14,358 results for: cas9 genes
-
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
Tags3x FLAGExpressionMammalianPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev2
Plasmid#81207Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGY18
Plasmid#221708PurposeEmpty Cas9 vector for multiplex gene editing in fungiDepositorTypeEmpty backboneUseCRISPR; AspergillusExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
NG-ABEmax
Plasmid#124163PurposeA-to-G base editorDepositorInsertTadA-TadA(evo)-Cas9-NG
ExpressionMammalianAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 nog
Plasmid#115480PurposeCRISPR-Cas9 SunTag system to target VP64 to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_NLS_linker_VP64_linker sfGFP_scFv_UBQ10_Insulator UBQ10_Ω dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-2
Plasmid#61737PurposeStreptomyces expression of codon-optimized Cas9 and custom gRNADepositorInsertssSpCas9
gRNA cassette
UseCRISPRExpressionBacterialMutationBbsI-flanked lacZ cassette inserted in place of s…Promotergapdhp(EL) and rpsL(XC)-BbsIAvailable SinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
4xNLS-pMJ915v2
Plasmid#88917PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv2
Plasmid#221139PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).DepositorInsert3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
UseCRISPRTags3xFLAGExpressionBacterialPromoterlacIq-PtacAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 nog
Plasmid#120251PurposeCRISPR-Cas9 SunTag system to target VP64 to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_NLS_linker_VP64_linker sfGFP_scFv_UBQ10_Insulator_ UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIW601-KmCRISPR
Plasmid#98907PurposeK. marxianus CRISPR Plasmid for sgRNA cloningDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3613
Plasmid#42251PurposeExpresses Cas9 nuclease (Streptococcus pyogenes) from CMV and T7 promotersDepositorInsertStreptococcus pyogenes Cas9
UseCRISPR; Zebrafish expressionPromoterCMVAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only