-
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorTagsExpressionMutationPromoterAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGWBhis03-Citrine-NLS
Plasmid#188558PurposeBinary vector for the expression of Citrine-NLS with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine-NLS and MpIGPDm
UseCRISPR; Entry vectorTagsExpressionMutationPromoterAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-VP64_Blast
Plasmid#192655Purpose3rd generation lenti vector encoding scFv-VP64 with 2A Blast resistance markerDepositorInsertscFv-VP64
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18
Plasmid#172318PurposeCRISPR dCas9 SunTag system to target a variant of bacterial DNA methyltransferase MQ1 to install CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_MQ1(Q147L)_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-p65-HSF1-Blast
Plasmid#192652Purpose3rd generation lenti vector encoding scFV-p65-HSF1 with 2A Blast resistance markerDepositorInsertscFv-p65-HSF1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB1678 CMV-HIVNES-GS-Cas13bt1
Plasmid#176316PurposeCMV-HIVNES-GS-Cas13bt1 (human codon optimized Cas13bt1 expression)DepositorInserthuman codon optimized Cas13bt1
UseCRISPRTagsHIV NESExpressionMammalianMutationPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry Codon 59 sgRNA
Plasmid#109431PurposeMLM3636 backbone containing a gRNA that guides Cas9 to codon 59 of mCherry in the ACE reporterDepositorInsertmCherry codon 59 gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dzCas9-Act3.0
Plasmid#158414PurposeCRISPR-Act3.0 system containing dzCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdzCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dSpRY-Act3.0
Plasmid#158416PurposeCRISPR-Act3.0 system containing dSpRYCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdSpRY-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-Act3.0
Plasmid#158408PurposeCRISPR-Act3.0 system containing dpcoCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
INT_SS9sp
Plasmid#212145PurposeEffector plasmid for for operon integration into the genome (Safe Site 9) using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC
UseTagsExpressionBacterialMutationPromoterpJ23119Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2b-srt-his
Plasmid#124804PurposeHDR template to knock-in mouse IgG2b Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2b producing cell lines.DepositorInsertMurine IgG2b
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2a-srt-his
Plasmid#124803PurposeHDR template to knock-in mouse IgG2a Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2a producing cell lines.DepositorInsertMurine IgG2a
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG1-srt-his
Plasmid#124802PurposeHDR template to knock-in mouse IgG1 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG1 producing cell lines.DepositorInsertMurine IgG1
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoter-Available sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mA-srt-his
Plasmid#124806PurposeHDR template to knock-in mouse IgA Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgA producing cell lines.DepositorInsertMurine IgA
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG3-srt-his
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only