We narrowed to 30,760 results for: ple
-
Plasmid#55640PurposeDre-Dependent ChR2-EYFPDepositorInserthChR2(H134R)-EYFP
UseAAVTagsEYFPExpressionMammalianPromoterEf1aAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαq-LgB97
Plasmid#134360PurposeNanoluc complementation assay. Expression of Gαq protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 97 and 98 of Gαq. Addition of the HA epitope at N terminus of Gαq.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA32 (MSW#497)
Plasmid#208068PurposeExpression of GFP-tagged hsRPA2 in human cellsDepositorAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3- SREBP-1
Plasmid#204192PurposeMammalian expression of SREBP-1 (isoform 1)DepositorInsertSREBP-1 (SREBF1 Human)
TagsE-tag and T7x2ExpressionMammalianMutationmultiple silent mutationsAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSF3-Flag-CBir-FRB_Myc-NBir-FKBP
Plasmid#90003PurposeSplit-BioID plasmid: Expresses N-terminally tagged CBir[257-321]-FRB and N-terminally tagged NBir[2-256]-FKBPDepositorInsertsNBirA*-linker-FKBP
CBirA*-linker-FRB
UseRetroviral; Flp/frtTagsFLAG and MycExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSL1145 (pSPIN, pBBR1 backbone, R*MmeI)
Plasmid#160736PurposeSingle-plasmid V. cholerae CAST, encodes all proteins, crRNA, and donor DNA. Non-targeting crRNA with BsaI sites for spacer cloning. Mini-tn has MmeI site in R end for Tn-seq. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8629 pHR-HREYBTATA-RR12EE345L-C term (406) dLbCpf1-2XNLS-miniVPR-mCherry-EFS-Puro-WPRE
Plasmid#140227PurposeHypoxia-inducible expression of leucine zipper with C terminal dCpf1 (Cas12a) 406-split half fused to miniVPR. Constitutive EFS-driven puromycin resistance.DepositorInsertzipper with dLbCpf1 (Cas12a) C terminal half (406) fused to miniVPR
UseLentiviralExpressionMammalianPromoterHRE (Hypoxia inducible)Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-HNRNPA1C-mCh-Cry2WT
Plasmid#101226PurposehnRNPA1(186-320) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi1-LgB91
Plasmid#134342PurposeNanoluc complementation assay. Expression of Gαi1 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi1. Addition of the HA epitope at N terminus of Gαi1.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE1-1_pLVX-EF1a-BirA-P2A-FB-dCas9-IRES-zsGreen1
Plasmid#138417PurposeCAPTURE1.1 vector containing BirA-V5-His, P2A, FB-dCas9, IRES and zsGreen1DepositorInsertsBirA
dCas9
UseLentiviralTagsFLAG, Avi-tag and V5, HisPromoterEF1aAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACt-mCherry-NES
Plasmid#138215PurposeEncodes residues 1-469 of rat soluble adenylyl cyclase (ADCY10) fused to mCherry; cytosol targeted.DepositorInsertsACt-mCherry-NES (Adcy10 Rat)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p190-FLAG
Plasmid#205620PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p190 isoform b3a2
TagsFLAGExpressionMammalianMutationT117M- Please see depositor commentsPromoterCMVAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
LiOn-CAG∞GFP
Plasmid#154015PurposeVector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein EGFP from a CAG promoter upon action of the piggyBac transposaseDepositorInsertEGFP
ExpressionMammalianPromoterCAGAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Dre
Plasmid#55633PurposeExpresses Dre in Mammalian CellsDepositorInsertsmCherry
Dre
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-NOG(AtUBI10)
Plasmid#202016PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-sfGFP-VP64-GB1) under the control of the AtUBI10 promoter.DepositorInsertsdCas9-24XGP41
NbGP41P-sfGFP-VP64-GB1
TagsGB1 and sfGFPExpressionPlantPromoterAtUBI10Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only