We narrowed to 5,122 results for: NOG
-
Plasmid#63802PurposeSP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; drosophila vectorDepositorInsertSP-dCas9-VPR
UseCRISPR and Synthetic BiologyTagsVPR (VP64-p65-Rta)ExpressionInsectPromoteract5cAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-smGdP-10XHA
Plasmid#217511PurposeKD Recombinase dependent conditional smGdP-10XHA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-smGdP-10XHA
TagssmGdP-10XHAExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-smGdP-10XOllas
Plasmid#217512PurposeKD Recombinase dependent conditional smGdP-10XOllas cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-smGdP-10XOllas
TagssmGdP-10XOllasExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-ANLN
Plasmid#31203DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha1 P35S:PhiC31 integrase-RDF:T35S (GB2893)
Plasmid#160633PurposeTU for the constitutive expression of the PhiC31 integrase, C-terminally fused with its reversion factor (RDF)DepositorInsertPhiC31-RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoter35SAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
TKTL1
Plasmid#72419PurposeStudy the role of aberrant expression of TKTL1 in HNSCC tumorigenesisDepositorInsertTKTL1 (TKTL1 Human)
ExpressionMammalianMutationmay have one or two synonymous substitutionsPromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EMCV_3C
Plasmid#201941PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HRV-B14_3C
Plasmid#203466PurposeExpresses HRV-B14 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Gal4-entry+NLS
Plasmid#128013PurposeVector containing the Gal4-entry expression cassette with SV40 NLS and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertGal4 DBD-SV40NLS-3x-Flag
UseGal4 entry vector with nls to generate tethering …TagsGal4-DBD-SV40NLS-3xFlagAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_mNeonGreen::3xFLAG::dCrk
Plasmid#131137PurposeUASp construct for over-expression of Drosophila Crk with N-terminal monomeric NeonGreen and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-E2F1
Plasmid#37141DepositorInsertE2F1 (E2f1 Fly)
UseGatewayAvailable SinceJune 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGS-CD64-2
Plasmid#109191PurposeEncodes full-length engineered CD64 with C-terminal Twin-Strep tag to be expressed in a baculovirus/insect cell expression systemDepositorInsertFull-length engineered CD64, derived from human CD64
TagsTwin-StrepExpressionInsectMutationengineered for efficient expression, see publicat…PromoterPolyhedrinAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMEXneo-TrkC
Plasmid#190202PurposeTo express the Human TrkC receptor under the Moloney mouse sarcoma virus LTR.DepositorInsertTrkC (NTRK3 Human)
UseEucaryoticExpressionMammalianPromoterMoloney mouse sarcoma virus LTRAvailable SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-KUNV_NS2B-GS-NS3
Plasmid#203506PurposeExpresses KUNV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorInsertKUNV NS2B-GS-NS3
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-HOXA1
Plasmid#31209DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega2_Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1678)
Plasmid#160642PurposeModule for the dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertGRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_tdTomato::3xFLAG::dCrk
Plasmid#131138PurposeUASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only