We narrowed to 24,790 results for: Spr
-
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-SNAP-CD4-bla
Plasmid#179447PurposeDonor vector to knock in SNAPtag C-terminal to human CRY1 geneDepositorInsertSnapTag
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.S.VSVg_mCherry-NLS
Plasmid#178269PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.VSVg_mCherry-NLS
Plasmid#178261PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.S_mCherry-NLS
Plasmid#178260PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.VSVg_mCherry-NLS
Plasmid#178255PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.VSVg_mCherry-NLS
Plasmid#178246PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.S_mCherry-NLS
Plasmid#178245PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.VSVg_mCherry-NLS
Plasmid#178241PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.S_mCherry-NLS
Plasmid#178240PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.HSV_mCherry-NLS
Plasmid#178237PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.VSVg_mCherry-NLS
Plasmid#178225PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_2
Plasmid#124911PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_3
Plasmid#124913PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.V5_mCherry-NLS
Plasmid#178215PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.Ollas_mCherry-NLS
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc AspCas12a
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.S_mCherry-NLS
Plasmid#178276PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; gcry1:BFP -0
Plasmid#173889PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyAvailable SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; gcry1:BFP -1
Plasmid#173890PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria3
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available SinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
AcrIIC1X* (AcrIIC1X-mCherry chimera)
Plasmid#128114PurposeExpresses AcrIIC1(N3F/D15Q/A48I) fused to mCherry; mediates potent inhibition of both, N. meningitidis as well as S. aureus Cas9DepositorInsertAcrX* (AcrIIC1 N3F/D15Q/A48I fused to mCherry)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1/7SK hybrid)-EF1as_Thy1.1_P2A_Neo
Plasmid#239609PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and minimal H1/7SK hybrid promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1/7SKhybrid-filler
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-36XMYC array
Plasmid#236380PurposeExpression of array of 36 crRNAs targeting MYCDepositorInsert36xMYC crRNA array (MYC Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xEFNA1 array
Plasmid#236382PurposeExpression of array of 48 crRNAs targeting EFNA1DepositorInsert48xEFNA1 crRNA array (EFNA1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-FAM13A
Plasmid#185550PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting FAM13ADepositorInsertFAM13A gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only