We narrowed to 9,939 results for: CAG
-
-
pCS2-mkgDUX4mal*mqg*
Plasmid#21174DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available sinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mqg*
Plasmid#21175DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 6163 (numbering acco…Available sinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
p-AAV-sh[SNCA]
Plasmid#75437Purposeknockdown alpha-synuclein in rat neuronsDepositorAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pERB217
Plasmid#61500PurposeConst. Halotag-GFP-Mito + mCherry-DHFRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsHaloTag-GFP-Mito
mCherry-DHFR
TagsHaloTag and mCherryExpressionMammalianAvailable sinceFeb. 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA NEAT1pr_v2
UseCRISPRPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
Plasmid#221233PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9(D10A)-P2A-EGFP
ExpressionMammalianAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-FOXM1-shRNA-84
Plasmid#89496PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable sinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgTP53(A)
Plasmid#85559PurposeExpresses sgRNA targeting human TP53 around codon F109DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTER E2F1shRNA human
Plasmid#66883PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F1DepositorAvailable sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Chx10 (164bp crit)+SV40p-tdTomato-IRES-AP
Plasmid#18811DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChx10 (164bp crit)+SV40p-tdTomato-IRES-AP
ExpressionMammalianAvailable sinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorAvailable sinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUPERIORpuro-shGAS5
Plasmid#46370DepositorAvailable sinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD3_3
Plasmid#36373DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR/U6 HDAC5 shRNA
Plasmid#32222DepositorPublicationAvailable sinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCX-H2B-KikGR
Plasmid#98649PurposeExpresses a nuclear-localized photoconvertible green-to-red fluorescent proteinDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKikGR
TagsH2BExpressionMammalianPromoterCMV-IE enhancer chick beta actin promoterAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL3-pegRNA-attL2
Plasmid#213052PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL3 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
AKT1 gRNA (BRDN0001146935)
Plasmid#75500Purpose3rd generation lentiviral gRNA plasmid targeting human AKT1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by
