We narrowed to 5,756 results for: PEP
-
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBM019
Plasmid#128179PurposeConstruct for generating stable Cas9-expressing Toxoplasma gondiiDepositorInsertssgRNA#1
SpCas9
Chloramphenicol acetyltransferase
UseCRISPR; Toxoplasma gondii expressionTags3X FLAG and Nuclear Localization SignalPromoterTUB1 (Toxoplasma gondii), U6 (Toxoplasma gondii),…Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTS117 His14-Avi-45xGS-anti GFP nanobody
Plasmid#199370PurposeBacterial expression plasmid for anti-GFP nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-GFP nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
SSTR2-DuET
Plasmid#213377PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSTR4-DuET
Plasmid#213379PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSTR5-DuET
Plasmid#213380PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His hTFNG
Plasmid#67240PurposeExpresses N-His tagged nonglycosylated human serum transferrin in mammalian cellsDepositorInserthuman serum transferrin (TF Human)
TagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationAsn413 Asp, Asn611AspPromoterSV40Available SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
mRFP-LAP2β
Plasmid#228029Purposelentiviral construct for mRFP-LAP2β expressionDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyDock
Plasmid#124618PurposeExpresses SpyDock to bind SpyTag non-covalently for affinity purificationDepositorInsertSpyDock
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
anti-FLAG M2 heavy chain
Plasmid#175359PurposeMammalian expression vector for over-expression of anti-FLAG M2 heavy chain (C-terminal His8)DepositorInsertanti-FLAG M2 heavy chain
TagsHis8 tag and N-terminal secretion signal peptide …ExpressionMammalianMutationL51I (see paper)PromoterCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2
Plasmid#135504PurposeMammalian expression of myc-tagged HLA-A*02:01DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV9retro
Plasmid#224687PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap9retro
UseAAVMutationinsertion of 10-mer peptide from AAV2retro (LADQD…Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p221z-erTagRFP
Plasmid#71266PurposeEntry clone containing ER-localized TagRFP. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGateway CloningTagsER retention signal HDEL and signal peptide (ER)…Available SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASP
Plasmid#111585PurposeAn AAV vector that expresses double floxed myristoylated iRFP670 with V5 tag and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyriRFP670V5-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MTNR1B-DuET
Plasmid#213349PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTNR1A-DuET
Plasmid#213348PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
MRGPRX4-DuET
Plasmid#213347PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MRGPRG-DuET
Plasmid#213343PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
8522-M01-663
Plasmid#225660PurposeLentiviral expression of a cancer stem cell reporter that responds to presence of Sox2/Oct4 or their paralogs (green configuration)DepositorInsertdsCopGFP
UseLentiviralPromoterSORE6-mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only