We narrowed to 2,922 results for: GFP reporter gene
-
Plasmid#213763PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#1-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-eGFP-KDEL
Plasmid#177728PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFlucDM
TagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cux1-SE(HS)-eGFP-PGK-H2BRFP
Plasmid#241867PurposeHair shaft (HS)-specific Cux1 epicenter-driven fluorescent reporterDepositorInsertCux1-SE(HS)-eGFP
UseLentiviralExpressionMammalianAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-MGT4-d2EGFP_CMV-mCherry
Plasmid#213764PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#4-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-CLGT3-d2EGFP_CMV-mCherry
Plasmid#213766PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertCLGT#3-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-eGFP-KDEL
Plasmid#177727PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFluc
TagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ control UTRs
Plasmid#67929PurposeTranslational reporter - control UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralExpressionMammalianAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ Emi1 5' and 3'UTR
Plasmid#67930PurposeTranslational reporter - Emi1 UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralExpressionMammalianAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.ARID3a.IRES.GFP
Plasmid#169300PurposeConstitutive overexpression of human ARID3A cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.mArid3a.IRES.GFP
Plasmid#169309PurposeConstitutive overexpression of murine Arid3a cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
4xPylT(AGGA)Ev2 PylS mCherry-P2A-eGFP(AGGA)
Plasmid#174529PurposeDual-fluorescence reporter for quantifying PylT(AGGA)Ev2 decoding efficiencyDepositorInsertsPylS
PylT
TagsFlagExpressionMammalianPromoterU6Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPRKCZ-C1-EGFP (C-PRKCZ-C1)
Plasmid#217759PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC1 domain (aa 123-193)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-PRKCZ-C1 (N-PRKCZ-C1)
Plasmid#217760PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC1 domain (aa 123-193)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
HIV-1-GFP ΔEnv
Plasmid#217437PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu.DepositorInsertgag/pol
UseLentiviralAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-GFP(39TAG)
Plasmid#217360PurposeExpression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmidDepositorInsertEnhanced green fluorescent protein
UseBaculoviralExpressionInsect and MammalianMutationY39TAGPromoterCMVAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-Inframe-noFSE
Plasmid#177619PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. No FSE was inserted. mCherry and GFP are expressed equally (positive control).DepositorInsertNone
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Zed_vector_tol2_-2.1prox1a_1:EGFP_XCA:DsRed2
Plasmid#218205PurposeZebrafish -2.1prox1a enhancer reporter in the lymphatic valve from 3 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a
UseZebrafish expressionAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Zed_vector_tol2_-2.1prox1a_1:EGFP_XCA:DsRed2
Plasmid#218207PurposeZebrafish -2.1prox1a_1 (mouse conserved) enhancer reporter in the lymphatic valve from 3 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a_1
UseZebrafish expressionAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/mCherry-DMDEx23
Plasmid#211367PurposeExpresses a DMD exon 23 skipping reporter in mammalian cells (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23
TagseGFPExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCMVAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Zed_vector_tol2_-2.1prox1a_2:EGFP_XCA:DsRed2
Plasmid#218208PurposeZebrafish -2.1prox1a_2 (not mouse conserved) enhancer reporter in the facial lymphatics at 5 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a_2
UseZebrafish expressionAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEaaK-NanR-J23113-pNanA-CadC-pCadBA-GFP
Plasmid#200277PurposeCharacterisation of the sialic acid-responsive circuit with fluorescent reporterDepositorInsertsCadC
NanR
ExpressionBacterialAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJFRC201-10XUAS-FRT>STOP>FRT-myr::smGFP-HA
Plasmid#63166PurposeGAL4-responsive UAS "flp-On" spaghetti monster GFP-HA reporterDepositorInsert"spaghetti monster GFP-HA"
TagsN-myristoylationExpressionInsectAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJFRC206-10XUAS-FRT>STOP>FRT-myr::smGFP-V5
Plasmid#63168PurposeGAL4-responsive UAS “flp-On” spaghetti monster GFP-V5 reporterDepositorInsert"spaghetti monster GFP-V5"
TagsN-myristoylationExpressionInsectPromoterGAL4-responsive UAS hsp70Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
C239-E02: attB2r-IRES-ffLuc2-eGFP-pA-attB3
Plasmid#162918PurposeGateway attB2r/attB3 entry clone for generation of polycistronic ffLuc2-eGFP reporter using an internal ribosome entry sequence (IRES)DepositorInsertfirefly luciferase/green fluorescent protein fusion with upstream IRES sequence
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSSA-eGFP (pXK-221)
Plasmid#208826PurposeThe SSA-based surrogate reporter for validating the activity of gene editing tools as well as for helping to screen gene-editing positive cells. Key Construct: CAG-PuroR-CMV-eGFP*(SSA).DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mCamk2a-EGFP
Plasmid#153197PurposeMouse Camk2a (mCamk2a) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-CAG-EGFP
Plasmid#153186PurposeCAG promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hIsl2-EGFP
Plasmid#153206PurposeHuman Isl2 (hIsl2) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR-eGFP (pXK-1647)
Plasmid#208824PurposeThe HDR-based surrogate reporter for validating HDR-editing activity of different gene editing tools as well as for helping to screen HDR-editing positive cells. Key Construct: CAG-PuroR-CMV-eGFP*(HDRDepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT1-d2EGFP
Plasmid#201447PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT2-d2EGFP
Plasmid#201448PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT2_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT4-d2EGFP
Plasmid#201449PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT4_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-NeoCOVGT3-d2EGFP-mCherry
Plasmid#201450PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUASM1:GFPNLS-SV40pA
Plasmid#155123PurposeTol2 vector containing QUASM1 reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUASM1:GFPNLS
UseZebrafish expressionPromoterQUASM1-E1bAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286D)
Plasmid#127391PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286D)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to Aspartic acidPromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EGFP-Bulged-miR-19
Plasmid#91976PurposeEGFP reporter cell line with eight bulged miR-19 sitesDepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286A)
Plasmid#127390PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-HA-GFP11-KDEL
Plasmid#177722PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-M3(T3D)471-721
Plasmid#56657PurposeGFP reporter for cytoplasmic inclusions formed by the fused, C-terminal region of protein muNS from mammalian orthoreovirus Type 3 DearingDepositorInsertM3(T3D)421-721
TagsEGFPExpressionMammalianMutationinsert encodes aa 471-721 + native stop codon of …PromoterCMV-IEAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
EW410 IKZF1tar x8-H2B-GFP
Plasmid#236156PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight IKZF1 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight IKZF1 binding sit…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- sfGFP
Plasmid#190051PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
EW409 ZNF250tarv3 x8-H2B-GFP
Plasmid#236133PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF250 binding si…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pYjjZ-RBS- sfGFP
Plasmid#190054PurposeGFP containing reporter plasmid expressing it under the control of the reportedely OxyR/H2O2 inducible pYjjZ promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pKatG-RBS- sfGFP
Plasmid#190053PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pKatG promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pOxyS-RBS- sfGFP
Plasmid#190052PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pOxyS promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-HA-GFP11-KDEL
Plasmid#177723PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFlucDM
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-MCS-P2A-GFP-PuroR
Plasmid#107186PurposeBase plasmid for cloning gene duplication alleles with eGFP reporter.DepositorTypeEmpty backboneAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only