We narrowed to 9,612 results for: Coli
-
Plasmid#112603PurposeUsed for expression of protein in E. coli as TEV cleavable N-terminal Avi-His8-tag and GB1 fusionsDepositorTypeEmpty backboneTagsAvi - 8His-GB1ExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pOP3MP
Plasmid#112600PurposeUsed for expression of protein in E. coli as PreScission cleavable N-terminal Avi-His8-tag and MBP fusionsDepositorTypeEmpty backboneTagsAvi - 8His-MBPExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOP3TP
Plasmid#112604PurposeUsed for expression of protein in E. coli as PreScission cleavable N-terminal Avi-His8-tag and thioredoxin fusionsDepositorTypeEmpty backboneTagsAvi - 8His-thioredoxinExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOP3TT
Plasmid#112605PurposeUsed for expression of protein in E. coli as TEV cleavable N-terminal Avi-His8-tag and thioredoxin fusionsDepositorTypeEmpty backboneTagsAvi - 8His-thioredoxinExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOP3BP
Plasmid#112602PurposeUsed for expression of protein in E. coli as PreScission cleavable N-terminal Avi-His8-tag and GB1 fusionsDepositorTypeEmpty backboneTagsAvi - 8His-GB1ExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sc PCNA-pET(11a)
Plasmid#239197PurposeOverexpress Sc PCNA in E. coliDepositorInsertPCNA
ExpressionBacterialAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP3GP
Plasmid#112606PurposeUsed for expression of protein in E. coli as PreScission cleavable N-terminal Avi-His8-tag and GST fusionsDepositorTypeEmpty backboneTagsAvi - 8His-GSTExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK BirA Hygro (w874-1)
Plasmid#29649DepositorInsertBirA
UseLentiviralExpressionMammalianAvailable SinceMay 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET32a-DEST
Plasmid#84652PurposeE. coli expression vector derived from pET32 with Gateway cassette.DepositorTypeEmpty backboneTagsHis, S tag, and Trx TagExpressionBacterialPromoterT7Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR L1-13XLexAop2-R5
Plasmid#41433DepositorInsert13XLexAop2
ExpressionBacterialAvailable SinceNov. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pENTR L1-13XLexAop2-L4
Plasmid#41434DepositorInsert13XLexAop2
ExpressionBacterialAvailable SinceNov. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_1EDG
Plasmid#234144PurposeHeterologous protein expression of GUNA_RUMCH in Escherichia coliDepositorInsert1EDG
Tags10x HisTag-Smt3ExpressionBacterialPromoterT7Available SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-U6-crRNA-empty
Plasmid#134921PurposeComponents for genome editing in mammalian cells with pPB-CAG-hCas3 and pCAG-All-in-one-hCascade.DepositorInsertcrRNA for CRISPR-Cas3
ExpressionMammalianPromoterU6Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Thy1StTA
Plasmid#97411PurposeTET driver for amplified expression in cortical neuronsDepositorInserttTA
UseAAVExpressionMammalianPromotermouse thy1PSsAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
amajLime chromoprotein
Plasmid#117843PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses amajLime chromoprotein in E. coliDepositorInsertpromoter, RBS, amajLime
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
fwYellow chromoprotein
Plasmid#117841PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses fwYellow chromoprotein in E. coliDepositorInsertpromoter, RBS, fwYellow
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
aeBlue chromoprotein
Plasmid#117846PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses aeBlue chromoprotein in E. coliDepositorInsertpromoter, RBS, aeBlue
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only