We narrowed to 7,670 results for: 11
-
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-BTC-ScNeo
Plasmid#209898PurposeTo monitor the status of Betacellulin, the plasmid encodes a recombinant BTC fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-Necl5-ScNeo
Plasmid#209901PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-FLAG-TAOK2
Plasmid#197862PurposeExpression of FLAG-tagged TAOK2 / PSK1 alpha in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight A173
Plasmid#53615PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-A173
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
TagsGST tagExpressionBacterialMutationdeleted amino acids 1-43Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-RHOA
Plasmid#183836PurposeRepair template for the N-terminal tagging of RhoA with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertRHOA homology arms with mNeonGreen-linker (RHOA Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.H1-NP
Plasmid#134367PurposeNanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.DepositorInsertH1-NP (HRH1 Human)
TagsFlag and natural peptide of nanoluciferaseExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFPV25-cR-2iG
Plasmid#204618PurposeFluorescent reporter for SPI2 induction in SalmonellaDepositorInsertsrpsM promoter
sseA promoter
TagsGFP and dsRedExpressionBacterialAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab7a-7
Plasmid#56443PurposeLocalization: Ras GTPase, Excitation: 488, Emission: 507DepositorInsertRab7a (RAB7A Human)
TagsEGFPExpressionMammalianMutationN117S in NM_004637.5PromoterCMVAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
FH1-MGT#2-mCherry_PGK-H2B-CFP
Plasmid#164102PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 UBXN2A
Plasmid#113505PurposeBacterial expression of GST-tagged UBXN2ADepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRIVE-CAG-hFX-HA
Plasmid#14994DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSNRK
Plasmid#138694PurposeExpresses a human SNRK-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaDMDR7-U6-SaDMDL2
Plasmid#78603PurposeAAV vector containing gRNAs (for SaCas9) targeting Dmd introns 22 and 23DepositorInsertU6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only