We narrowed to 33,795 results for: IND
-
Plasmid#159994PurposeBacterial expression of dCas9-BirA*DepositorInsertdCas9-BirA*
Tags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-SspB (pBS1144)
Plasmid#185326PurposeFor the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
JA740
Plasmid#49939PurposeExpresses a TALE-TET1FL (full length TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-SopB
Plasmid#183670PurposeInducible Salmonella Typhimurium SopB for expression in yeastDepositorAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-Leu-SopB(C460S)
Plasmid#183671PurposeInducible Salmonella Typhimurium SopB (catalytically inactive) for expression in yeastDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
ExpressionYeastMutationC460SPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-CIBN
Plasmid#183937PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to optogenetic CIBN domain; bound by PHR upon blue light exposureDepositorInserttdPCP-CIBN (CIB1 Mustard Weed, Synthetic)
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3762
Plasmid#49947PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-4 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 AUP1 292-410
Plasmid#185331PurposeBacterial expression of AUP1 with GST fusion protein for binding assaysDepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
JA524
Plasmid#49938PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
R619-M67-303: CMV51p> SARS-CoV-2 S-RBD(319-541)-His6
Plasmid#166018Purposemammalian expression of SARS-CoV-2 spike receptor-binding domain (RBD)DepositorAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-R270X
Plasmid#48092PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-R270XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
ExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_mCh-SspB (pBS1142)
Plasmid#185324PurposeFor the mammalian expression of the human protein ApoE2 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
3021_pETcon-SARS-CoV-2-RBD_K417N_E484K_N501Y
Plasmid#184406Purposeyeast surface display of the SARS-CoV-2 Beta variant RBDDepositorInsertSARS-CoV-2 Beta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationK417N+E484K+N501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-G273X
Plasmid#48093PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-G273XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
ExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS
Plasmid#59388PurposeDestination vector with RBPMS for stable cell line generationDepositorAvailable SinceFeb. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-Idax DBM
Plasmid#68554PurposeThis plasmid expresses full length IDAX containing a DNA binding mutation.DepositorInsertIDAX-DBM (Cxxc4 Mouse)
TagsMycExpressionMammalianMutationT162A, H164A and Q165A mutationsPromoterEF1aAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677)
Plasmid#160641PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.DepositorInsertERLexABDGal4AD / PhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only