We narrowed to 10,523 results for: ESP
-
Plasmid#15738DepositorAvailable SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-FLAG LIP
Plasmid#15737DepositorAvailable SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-let-7 WT
Plasmid#78260PurposepsiCHECK2 dual luciferase reporter harboring a fully complementary let-7 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertfully complimentary let-7 target site
UseLuciferase; Microrna activityExpressionMammalianAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HDAC6.DC-FLAG
Plasmid#30483DepositorInsertHDAC6 (HDAC6 Human)
TagsFLAGExpressionMammalianMutationCatalytically inactive mutant (H216/611A)Available SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
CTV
Plasmid#15912DepositorInsertCAG-STOP-eGFP-ROSA26TV
UseCre/Lox; /stopAvailable SinceOct. 26, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-GFP
Plasmid#104061PurposeAAV expression of nuclear localized GFP with SV40 NLSDepositorHas ServiceAAV PHP.eBInsertGFP
UseAAVPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUGW-ER-TurboID
Plasmid#200965Purpose3rd gen lentiviral plasmid for expressing endoplasmic reticulum localized TurboID with EGFPDepositorInsertER-TurboID
UseLentiviralTagsEGFPExpressionMammalianAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pALOD4 non-binding mutant
Plasmid#111027PurposeExpresses non-binding mutant version of p-ALOD4, has six inactivating mutations (G501A, T502A, T503A, L504A, Y505A, and P506A)DepositorInsertDomain 4 of Anthrolysin O
TagsHis6 tagExpressionBacterialMutationMutations: S404C, C472A, G501A, T502A, T503A, L5…PromoterT7Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Golgi-TurboID
Plasmid#200959PurposeTransiently expresses golgi localized TurboID with HA tagsDepositorInsertGolgi-TurboID
TagsHAExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2515
Plasmid#91072PurposeModule B, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
sAB-K29
Plasmid#204735Purposesynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitinDepositorInsertsynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitin
Available SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUGW-Golgi-TurboID
Plasmid#200964Purpose3rd gen lentiviral plasmid for expressing golgi localized TurboID with EGFPDepositorInsertGolgi-TurboID
UseLentiviralTagsEGFPExpressionMammalianAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBA409
Plasmid#85971PurposeEF1a-sfGFP-Ubc-NeoDepositorInsertssfGFP
Neo
UseLentiviralExpressionMammalianAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCE27
Plasmid#174405PurposeC. auris LEUpOUT NAT marker gRNA expression construct. Use with pCE35 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE35
Plasmid#174409PurposeC. auris LEUpOUT NAT marker CAS9 expression construct. Use with pCE27 gRNA expression construct.DepositorInsertC. auris LEU2 1 of 2, pENO1, Cas9, NAT 1 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUGW-Cytosol-TurboID
Plasmid#200961Purpose3rd gen lentiviral plasmid for expressing cytosol localized TurboID with EGFPDepositorInsertCytosol-TurboID
UseLentiviralTagsEGFPExpressionMammalianAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
HypoxCR
Plasmid#59946PurposeA lentiviral dual fluorescent protein reporter, HypoxCR, detects hypoxic [hypoxia-inducible factor (HIF) active] and/or cycling cells.DepositorInsertsGFP-Pest
mCherry-Geminin
UseLentiviralTagsFLAG and PESTExpressionMammalianPromoterCMV and min CMVAvailable SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only