We narrowed to 43,360 results for: INA
-
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB3-V5/HIS
Plasmid#201104Purposeexpression of human ERBB3 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB3 receptor tyrosine kinase, full length, wildtype (ERBB3 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N3-EPAC1
Plasmid#113110PurposeHuman EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).DepositorAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7
Plasmid#180315Purposemammalian expression of human SEPT7 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-ubi:QFGal4-SV40pA
Plasmid#155119PurposeTol2 vector for ubiquitous expression of QFGal4. Contains cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertubi:QFGal4 (ubb Budding Yeast, Neurospora crassa, Zebrafish)
UseZebrafish expressionPromoterubiquitin BAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835Y-V5/HIS
Plasmid#236007Purposeexpression of the D835Y kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid Leukemia and Acute Lymphoblastic LeukemiaDepositorInserthuman FLT3-D835Y receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Blast-DNTGFBR2-HA
Plasmid#130888PurposeExpresses dominant negative mutant human TGFBR2DepositorInsertTGFBR2 (TGFBR2 Human)
TagsHA-tagExpressionMammalianMutationDominant Negative receptor lacking cytosolic cata…PromoterCMVAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CIB1-mCerulean-MP
Plasmid#58366PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorTagsmCeruleanExpressionMammalianPromoterCMVAvailable SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1D V5-His-TOPO-KGA.wt
Plasmid#110332PurposeMammalian expression of glutaminase isoform KGA (wild type) with V5 and 6xHis tagsDepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
DRH002_scAAV-hSyn-delta_iCre-HA
Plasmid#225087PurposeExpression of inactive delta-iCre (control) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertdelta_iCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VEGFR3-V5/HIS
Plasmid#205618PurposeExpression of human VEGFR3 receptor tyrosine kinase in mammalian cellsDepositorInsertVEGFR3 receptor tyrosine kinase (FLT4 Human)
TagsV5-HisExpressionMammalianMutationT28M, S455R- Please see depositor commentPromoterCMVAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABL1_HUMAN_D0
Plasmid#79727PurposeThis plasmid encodes the kinase domain of ABL1. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-mApple
Plasmid#180323Purposemammalian expression of human SEPT9_i3 fused to monomeric AppleDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_mApple-SEPT7 Gmut2
Plasmid#180317Purposemammalian expression of human SEPT7 Gmut2 fused to mAppleDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835N-V5/HIS
Plasmid#236008Purposeexpression of the D835N kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid LeukemiaDepositorInserthuman FLT3-D835N receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835N substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.KD.flag
Plasmid#19759DepositorInsertcyclin-dependent kinase 8 (CDK8 Human)
UseRetroviralTagsFlagExpressionMammalianMutationD173A (kinase dead)Available SinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only