We narrowed to 6,129 results for: cas9 expression plasmid
-
Plasmid#137844PurposeCas9 and gRNA expression plasmid for P. falciparum; no selection in parasites.DepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE2max-∆RNaseH-dualU6
Plasmid#198735PurposeAAV genome encoding C-terminal PE2max and U6 expression cassettesDepositorInsertNpuC-CtermPE2max∆RNaseH
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB_gRNA_S.pyogenes_scaffold_BB
Plasmid#226429PurposePiggyBac transposon vector backbone for cloning of sgRNA compatible with S.pyogenes dCas9 enzyme. BbsI Golden Gate site upstream of the scaffold for protospacer insertion. Puromycin selection marker.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_118
Plasmid#113667PurposeLentiviral vector expressing dCas9DepositorInsertdCas9
UseCRISPR and LentiviralMutationcatalytically inactiveAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
Plasmid#242662PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (human) (LLH301)
Plasmid#242661PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and human gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_human_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520_blastR
Plasmid#175289PurposeHuman expression plasmid for SpCas9 sgRNA with blasticidin co-selectionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMV/U6Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only