We narrowed to 5,500 results for: crispr cas9 grna plasmid
-
Plasmid#130942PurposeEngineered sgRNA-LEB4 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEB4
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY110
Plasmid#130940PurposeEngineered sgRNA-LEB3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEB3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY77
Plasmid#130964PurposeEngineered sgRNA-LEB2 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEB2
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY124
Plasmid#130946PurposeEngineered sgRNA-G6-2MS2 (2 MS2 aptamers) generator circuit including promoter PbadDepositorInsertsgRNA-G6-2MS2
UseSynthetic BiologyExpressionBacterialPromoterPbadAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY112
Plasmid#130944PurposeEngineered sgRNA-LEB5 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEB5
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY107
Plasmid#130943PurposeEngineered sgRNA-LEA5 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA5
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY105
Plasmid#130939PurposeEngineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY106
Plasmid#130941PurposeEngineered sgRNA-LEA4 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA4
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWT007h
Plasmid#107892PurposeW1.0.1c plasmid. Contains PTetO-SD8-Cas9, PLac-sgRNA(con.) and is part of CAMERA 1.0.1cDepositorInsertPTetO-SD8-Cas9, PLac-sgRNA(con.)
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-AAVS1
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.25
Plasmid#246894PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for UBAP2L Nterm.DepositorInsertUBAP2L Nterm Guide RNA 1 (UBAP2L Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330 PLIN2
Plasmid#202196PurposepX330 backbone expressing sgRNA to edit the C-terminus of human PLIN2DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTG131
Plasmid#198640PurposeThermosensitive pSC101-based plasmid expressing a sgRNA under the control of the J23119 promoter and Cas9 under the control of the DAPG-inducible PhlF promoterDepositorInsertCas9
ExpressionBacterialPromoterpPhlFAvailable SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-nBRD4/PITCh
Plasmid#91794PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4DepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterchicken β-actin promoterAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only