We narrowed to 5,362 results for: crispr cas9 grna plasmid
-
Plasmid#227286PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CEP135 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CEP135 (CEP135 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-Sauri C aa439-1061-U6-Camk2d sgRNA7
Plasmid#220129PurposeExpresses Sauri cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSauri Cas9C
UseAAV and CRISPRExpressionMammalianPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-SpC aa714-1368-U6-Camk2d sgRNA7
Plasmid#226916PurposeExpresses Sp cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSp Cas9C
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-SpG C aa714-1368-U6-Lmna sgRNA1
Plasmid#208110PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertSpG C, U6, Lmna sgRNA1, scaffold
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJOG252
Plasmid#80584Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pV1393
Plasmid#111430PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
Plasmid#226915PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSp Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMBEC6
Plasmid#187598PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Gentamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBEC2
Plasmid#187596PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Kanamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLP16_Lenti Scramble Control
Plasmid#239417PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KODepositorInsertScramble sequence
UseLentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only