We narrowed to 7,081 results for: mag
-
Plasmid#246096PurposeExpression of human PHF13 (1-150) with Flag tag in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pFlag-CMV4-PHF13 (100-200)
Plasmid#246095PurposeExpression of human PHF13 (100-200) with Flag-tag in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-HaloTag
Plasmid#247345PurposeExpresses H2B-Halo under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT
Plasmid#247342PurposeFLP/FRT based mammalian expression vector for mouse histone H3.1-EGFP, driven by mouse histone H3.1 promoter.DepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-PA-mCherry
Plasmid#247339PurposeExpresses photoactivatable H2B-Cherry under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-PAmCherry-FRT
Plasmid#247337PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-huCof R21Q-mRFP
Plasmid#245964PurposeExpression of the weak F-actin binding R21Q cofilin-mRFP which serves as a cofilactin rod reporter without inducing rodsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof K22Q-mRFP
Plasmid#245965PurposeExpression of the weak F-actin binding K22Q cofilin-mRFP which serves as a cofilactin rod reporter without inducing rodsDepositorAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG coca-5HT3-IRES-GFP
Plasmid#242193PurposeExpression vector for cocaine-gated chemogenetic cation channelDepositorInsertcoca-5HT3-IRES-GFP (Htr3a Mouse)
ExpressionMammalianMutationL141G G175K Y210F Y217FPromoterCAGAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TetOn-DEST-EFS-mODC-rtTA-IRES-NEO (JDW 931)
Plasmid#242578PurposePiggyBac transposon flanked, Tet-on, gateway destination vector.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DV-IRES-myr-mKate (JDW 494)
Plasmid#242575PurposeGateway destination vector with a CAGGS promoter in the backbone as well as an IRES-myr-mKate to label cell membranes.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianPromoterCAGGSAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-LiCre (JDW 1119)
Plasmid#242560PurposeGateway middle entry clone containing a light inducible Cre Recombinase (LiCre).DepositorInsertLiCre (AsLOV2-CreE340AD341A)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMEF2c-AHF-DreERT2 (JDW 196)
Plasmid#242586PurposeThe Mef2c anterior heart field promoter driving expression of a tamoxifen inducible Dre recombinase.DepositorInsertDreERT2
ExpressionMammalianPromotermouse Mef2cAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-deLACCO1-COBRA
Plasmid#223344PurposeBiosensor for extracellular L-lactateDepositorInsertdeLACCO1
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-eLACCO2-COBRA
Plasmid#223345PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-eLACCO2.1-COBRA
Plasmid#223346PurposeBiosensor for extracellular L-lactateDepositorInserteLACC02.1
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-IgK-R-eLACCO2-COBRA
Plasmid#223348PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mBaoJin-WPRE (JDW 1383)
Plasmid#242549PurposeGateway middle entry clone containing H2B-mBaoJin with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmBaoJin
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only