We narrowed to 19,553 results for: INO
-
Plasmid#49571Purposeexpresses the plekstrin homology domain of OSBP in mammalian cellsDepositorAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only
-
lenti sgRNA(MS2)_zeo backbone
Plasmid#61427Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMma PylT sfGPF 150TAG
Plasmid#154766Purposeplasmid with 4xMma PylT cassette and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, U25C in PylTPromoterEF1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2Psub-Kv-WPRE
Plasmid#247223PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2Psub in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIaDepositorInsertJEDI-2Psub-Kv
UseAAVTagsKvExpressionMammalianPromoterCaMKIIaAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMma PylT_FLAG-Mma PylRS AF
Plasmid#140023PurposePlasmid with 4xMmaPylT cassette and MmaPylRS AF for amber suppression; for transient or stable piggyBac-mediated integrationDepositorInsertMma PylRS (pylS Methanosarcina mazei)
TagsFLAGExpressionMammalianMutationY271A, Y349FPromoterEF1Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nme2Cas9_AAV
Plasmid#119924PurposeAll-in-one AAV plasmid expressing Nme2Cas9 with sgRNA cassetteDepositorInsertNme2Cas9
UseAAVTagsNLS-3xHA-NLS and NLS-NLSExpressionMammalianPromoterU1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
CyPET-Arf6
Plasmid#18840DepositorInsertCyPET-Arf6 (ARF6 Human)
ExpressionMammalianMutationThe sequence for the fluorescent protein CyPET wa…Available SinceAug. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJM230 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD-stRBS-lacZ)
Plasmid#110560PurposeminiTn7 delivery plasmid with rhaSR-PrhaBAD inducible promoter and StRBS-lacZ insertDepositorInsertstRBS-lacZ
ExpressionBacterialPromoterrhaSR-PrhaBADAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-mCh
Plasmid#108854PurposeEncodes for human VEGFR2 fluorescently labeled with mCherry on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PG13-luc (wt p53 binding sites)
Plasmid#16442PurposeLuciferase reporter containing 13 copies of the p53-binding consensus sequenceDepositorAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJL1
Plasmid#69496PurposepJL1 expression vector with sfGFPDepositorInsertSuper folder GFP
ExpressionBacterialPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMma PylT_FLAG-Mma PylRS
Plasmid#140009PurposePlasmid with 4xMmaPylT cassette and Mma PylRS for amber suppression; for transient or stable piggyBac-mediated integrationDepositorAvailable SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(F74G)
Plasmid#140730PurposeOsTIR1(F74G)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(F74G)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CanlonicSF
Plasmid#178342PurposeTo explore lactate dynamics in intact systemsDepositorInsertCanlonicSF
ExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mito-CanlonicSF/pCMV-myc-mito
Plasmid#224465PurposeTo explore mitochondrial lactate dynamicsDepositorInsertCanlonicSF
ExpressionMammalianPromoterCMVAvailable SinceNov. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-Flag-hGSDMD
Plasmid#218938PurposeExpression of N-terminal FLAG tagged human gasdermin DDepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pS548∙CsR
Plasmid#197859PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Tc resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only