We narrowed to 25,930 results for: gfp gene
-
Plasmid#11987DepositorInsertSignal transducer and activator of transcription 1 (STAT1 Human)
TagsGFPExpressionMammalianMutationA188T, Q718RAvailable SinceJuly 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCDNA_Lifeact-GFP_NLS-mCherry
Plasmid#69058PurposeDual Fluorescent Reporter for F-actin and NucleiDepositorInsertLifeAct-GFP_IRES_NLS-mCherry
TagsLifeact-GFP, NLS-mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-egfp-U3-Osp.gRNA
Plasmid#166034PurposeEmpty backbone for expression of gRNA-expressing integration deficient lentiviral particles.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFsynW SYP-GFP
Plasmid#197283PurposeEncodes for viral expression of full-length wild type synaptophysin (SYP). Visualized by a C-terminal GFP.DepositorInsertSYP and GFP (Syp Rat)
UseLentiviralTags1D4 epitopeMutationN/APromoterhSyn (human synapsin I promoter)Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW-GFP-CtIP
Plasmid#71109Purposemammalian expession of GFP-CtlPDepositorInsertCtlP
UseLentiviralTagsGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceDec. 9, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET_RGG-GFP-RGG
Plasmid#124948PurposeExpression of RGG-GFP-RGGDepositorAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLM-vexGFP-Oct4
Plasmid#22240Purpose2nd generation lentiviral vectorDepositorInsertvexGFP_2A_OCT4 (POU5F1 Human, synthetic fluorescent protein)
UseLentiviralAvailable SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSICO-eGFP-TNPO3
Plasmid#167590PurposeExpresses human TNPO3 fused to eGFPDepositorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-loxSTOPlox-LynEGFP
Plasmid#133922PurposeReporter expressing membrane targeted EGFP for visualization of neuronal morphology upon Cre-based recombinationDepositorInsertLynEGFP
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
IRES-puro-GFP
Plasmid#16616DepositorInsertGFP
ExpressionMammalianAvailable SinceMarch 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-EGFP-hFIP200
Plasmid#38192DepositorAvailable SinceNov. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin1 KI #3
Plasmid#139659PurposeEndogenous tagging of GluN1: N-terminal (amino acid position: A20)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBS1147 GFP-TDP43
Plasmid#118797PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorInsertTARDBP (TARDBP Human)
UseLentiviralAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-membrane-mEGFP
Plasmid#105526PurposeT7 promotor drives in vitro mRNA transcription of a mEGFP-tagged membrane reporterDepositorInsertGNAI2 (GNAI2 Human)
UseIn vitro transcriptionTagsmEGFPMutationfragment encoding the plasma membrane targeting s…PromoterT7Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK562 (pDS-GFP)
Plasmid#183129PurposeControl plasmid that expresses off-target dsRNADepositorInsertGFPmut3 (no RBS)
UseSynthetic BiologyAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B Q78L
Plasmid#89448PurposeExpression of GFP-tagged human Rab27B Q78L in mammalian cellsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 GFP-h-PKD2
Plasmid#83451PurposeGFP-tagged PC2 for Eukaryotic expression (883)DepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV:DsRed(FRT)GFP
Plasmid#31128DepositorInsertDsRed(FRT)GFP
UseFlp/frtExpressionMammalianAvailable SinceOct. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-EGFP-tDeg
Plasmid#185400PurposeEGFP-tDeg fluorogenic proteinDepositorInsertEGFP-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP in Artichoke
Plasmid#169931PurposeOverexpression of Full Length of BCL6-GFP fusionDepositorAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only