We narrowed to 4,838 results for: phy
-
Plasmid#55824PurposeExpresses S586A VLCAD mutant in mammalian cellsDepositorInsertVery long-chain specific acyl-CoA dehydrogenase (ACADVL Human)
UseTagsFLAG tagExpressionMammalianMutationchanged Serine 586 toAlaninePromoterCMVAvailable sinceJuly 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPKm-230
Plasmid#90499PurposepSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.DepositorInsertmito-tFD and mito-tFNR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
UseTagsExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…PromoterAvailable sinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*mqg*
Plasmid#21174DepositorInsertDUX4 (DUX4 Human)
UseTagsExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…PromoterAvailable sinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
BII-CMV-AfmW3A
Plasmid#133402PurposePiggybac vector for constitutive expression of Afamin + Wnt3a for production of conditioned media in HEK293T cellsDepositorUseTagsExpressionMammalianMutationN/APromoterCMVAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…ExpressionMutationPromoterAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF
Plasmid#100280PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
UseTagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoterAvailable sinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
BII-ChBtW-dnTCF4-ires-GFP
Plasmid#133378PurposePiggybac vector for constitutive expressionDepositorInsertdnTCF4 (TCF4 Human)
UseTags2x FlagExpressionMammalianMutationdeltaN31PromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-IMP2-2_antisense-control
Plasmid#42174DepositorInsertInsulin-like growth factor 2 mRNA binding protein 2-2 antisense control (IGF2BP2 Human)
UseTagsGFPExpressionMammalianMutationPromoterT7Available sinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAdCMV/V5-DEST-Y705F-STAT3-3xFlag
Plasmid#99261PurposeAdenoviral vector encoding Flag-tagged murine STAT3 (Y705F)DepositorInsertSignal transducer and activator of transcription 3 - Y705F (Stat3 Mouse)
UseAdenoviralTags3x-FlagExpressionMutationY705F (contains a silent mutation: nucleotide 271…PromoterCMVAvailable sinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-APLP1ICD-IRES-hrGFP
Plasmid#107546PurposeAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cellsDepositorInsertAPLP1ICD (APLP1 Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianMutationPromoterSynapsine promoter and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177365PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expressionDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianMutationPromoterCMV and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-hBVRA
Plasmid#100285PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for human BVRA
UseTagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable sinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
UseTagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorInsertAICD (APP Human)
UseAAVTagsExpressionMutationNonePromoterhuman synapsinAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
His6-TEV-CRBN-midi
Plasmid#215330PurposeCRBN midi construct for use in crystallography and biophysical studies enabling ligand and degrader designDepositorInsertCRBN (CRBN Human)
UseTags6xHis and TEVExpressionBacterialMutationcontains amino acids 41-187 followed by a Gly-Ser…PromoterlacIAvailable sinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSC-NGN2-IRES-ISL1-T2A-LHX3
Plasmid#221814PurposeLentiviral vector expressing human NEUROG2, ISL1 and LHX3 for inducing pluripotent stem cells into cholinergic motor neurons.DepositorUseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only