We narrowed to 14,166 results for: TIM;
-
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-H2B-tdTomato-SRT
Plasmid#203393PurposeAAV transfer plasmid containing H2B fused piggyBac self-reporting transposon with tdTomato marker for mammalian calling cardsDepositorInsertH2B fused piggyBac tdTomato self-reporting transposon
UseAAVTags3X SV40 and H2BExpressionMammalianPromoterEf1aAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRPM7 gRNA (BRDN0001147821)
Plasmid#76112Purpose3rd generation lentiviral gRNA plasmid targeting human TRPM7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTQ2
Plasmid#110196PurposeEncodes for human CXCR4 coding sequence tagged with the mTQ2 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD3-2A_pMI-LO
Plasmid#153418PurposeRetroviral (MSCV) expression of all four WT CD3 subunits, co-expressed with LSSmOrangeDepositorInsertmurine CD3 delta-gamma-epsilon-zeta subunits (Cd3d Mouse)
UseRetroviralExpressionMammalianAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001149544)
Plasmid#76841Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 proHB-EGF CS
Plasmid#11601DepositorInsertHB-EGF (HBEGF Human)
TagsHis and mycExpressionMammalianMutationConstitutively secreted HB-EGF: C-terminal amino …Available SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV2_CAG_oROS-HT_WPRE
Plasmid#216414PurposeEncodes the genetically encoded, chemigenetic fluorescent peroxide sensor oROS-HT in AAV viral vectorsDepositorInsertoROS-HT
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
xCas12i
Plasmid#195333Purposevector for encoding a human codon-optimized xCas12i driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized xCas12i
Tags3xFlagExpressionMammalianPromoterCBh, CMV, hU6Available SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VQR-P2A-EGFP (RTW3520)
Plasmid#139990PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VQR(D1135V/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVQR=D1135V/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FLAG-Akt2-CA
Plasmid#64050PurposeMyristoylated-FLAG-tagged Akt2, constitutively activeDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-LSSmOrange
Plasmid#110197PurposeEncodes for human CXCR4 coding sequence tagged with the LSS-mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-3xFLAG-YAP1-S127A
Plasmid#42239DepositorInsertYAP1 (YAP1 Human)
UseGatewayTags3xFLAGMutationSerine 127 changed to alaninePromoternoneAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRER-P2A-EGFP (RTW3160)
Plasmid#139991PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRER(D1135V/G1218R/R1335E/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRER with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRER=D1135V/G1218R/R1335E/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001149181)
Plasmid#76414Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001148547)
Plasmid#76415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-jYCaMP1
Plasmid#135423PurposeYellow protein calcium sensor expressed under human Synapsin1 promoter, for AAV production or direct transfectionDepositorInsertjYCaMP1
UseAAVExpressionMammalianPromoterhSynAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only