We narrowed to 9,328 results for: CAG
-
Plasmid#77690Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CASK gRNA (BRDN0001148068)
Plasmid#77403Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYLK gRNA (BRDN0001147172)
Plasmid#77021Purpose3rd generation lentiviral gRNA plasmid targeting human MYLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FGFR1 gRNA (BRDN0001146877)
Plasmid#76068Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001145533)
Plasmid#76034Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8 JARID2
Plasmid#114443PurposeEntry vector for gateway cloning containing human JARID2 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(46))-PGKpuroBFP-W
Plasmid#200504PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ARID1B_ZNF384
Plasmid#205772PurposeExpress mEGFP-tagged fusion protein, ARID1B_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CREBBP_ZNF384
Plasmid#205796PurposeExpress mEGFP-tagged fusion protein, CREBBP_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR8 PALI1
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR8 LCOR
Plasmid#114441PurposeEntry vector for gateway cloning containing human LCOR coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVL-FLAG/His PALI1
Plasmid#114449PurposeInsect baculovirus expression vector containing N terminal FLAG/His tagged human PALI1 coding sequenceDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP-SbMVseq-SbMVp-SbMVseq-FRB-VP16
Plasmid#210506Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP-SbMVseq-SbMVp-SbMVseq-FRB-VP16 component in mammalian cellsDepositorInsertPDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP-SbMVseq-SbMVp-SbMVseq-FRB-VP16
TagsMycExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
hSyn-PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP
Plasmid#210509Purposeexpresses PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP component in rat hippocampal neuron cellsDepositorInsertsTagsMycExpressionMammalianPromoterhSynAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVL-FLAG/His LCOR
Plasmid#114450PurposeInsect baculovirus expression vector containing N terminal FLAG/His tagged human LCOR coding sequenceDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only