We narrowed to 11,499 results for: aga
-
Plasmid#126450PurposeExpresses human TdT in mammalian cells. (pTBL206)DepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPN066
Plasmid#91601PurposeExpress sgRNA targeting human DPP4DepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
retro-puro vector
Plasmid#58250PurposeRetroviral expression vector encoding an empty IRES-Puromycin cassetteDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
UPB-esophagus (UPB5)
Plasmid#180783PurposeUnique Projection Barcode (UPB5)-Esophagus for Projection-seqDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP
Plasmid#61527PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-1
Plasmid#210013Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-IRP2
Plasmid#226621PurposeExpresses human IRP2 in insect cellsDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Foxo1-ADA 6KQ
Plasmid#17563DepositorInsertFoxo1 ADA 6KQ (Foxo1 Mouse)
TagsFlag and MycExpressionMammalianMutationK242, K245, K259, K262, K271 and K291 were replac…PromoterCMVAvailable SinceOct. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K(S441A/S445A)
Plasmid#110161PurposeExpression of human eEF2K (S441A/S445A) in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
TagsHAExpressionMammalianMutationS441A/S445APromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-HA
Plasmid#162100PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-TM-Kv2.1-CaM-NES-TevN-AsLOV2-TEVseq-tTA
Plasmid#171618PurposeAAV Soma-targeted Cal-Light with Kv2.1DepositorInsertTM-Kv2.1-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) NRP1 b1b2 (273-586)
Plasmid#162733PurposeBacterial expression the b1b2 tandem domains from the rat Neuropilin 1 receptor (NRP1). With an N-terminal 6His tag and thrombin cleavage site.DepositorInsertHuman NRP1 b1b2 domains (residues 273-586)
Tags6HisExpressionBacterialMutationCodon optimisedAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
SPDK3889(TRV-RNA2-pPEBV-MCS-AtMet-tRNA)
Plasmid#149277PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtMet-tRNA mobile RNA sequence
UseT-dna vectorMutationT2318C (DNA) in PEBV coat protein sequenceAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh2
Plasmid#69041Purpose3rd generation lentiviral vector expressing IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only