We narrowed to 9,360 results for: CAG
-
Plasmid#184480PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Xla.Tubb2:hGCGR-TEVcs-QF;he1.1:CFP
Plasmid#218857PurposeXla.Tubb2 promoter driving expression of human glucagon receptor, TEV protease recognition site, QF fusion protein for use in trans-Tango.DepositorAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP
Plasmid#64216PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFPExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBneo-CIBN-lin-p53CT(98-393)-6KQ-mNeonGreen-NLSx3
Plasmid#241848PurposeExpresses an improved localizer of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCIBN and mNeonGreenExpressionMammalianMutationp53 C-terminus (97-393 aa) containing six acetyla…PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
shYAP1 # 2
Plasmid#42541DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
nLuc-GLP-1R-His-FLAG
Plasmid#124831PurposeExpresses N-terminally NanoLuc-Tagged GLP-1R in mammalian cellsDepositorInsertGLP1R (GLP1R Synthetic, Human)
UseLuciferaseTagsFLAG, His6, and NanoLucExpressionMammalianPromoterCMVAvailable SinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
W45A mutant of H3K9me3 biosensor
Plasmid#120808PurposeFRET biosensor. Disrupting HP1 binding capability in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1(W45A mutation)-EV linker-ECFP-mouse histone H3
ExpressionMammalianMutationTryptophan 45 is mutated to Alanine 45 on HP1 dom…PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
K9L mutant of H3K9me3 biosensor
Plasmid#120807PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
ExpressionMammalianMutationlysine 9 is mutated to leucine 9 on histone H3PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3_nsgRNA(PP7)
Plasmid#232444PurposensgRNA for PE3 facilitation of a +1 T to A prime edit on the HEK3 locus, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3) for HEK3+1t>a edit driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0208
Plasmid#142556PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA1
Plasmid#92312PurposeCRISPR-GFP-gRNA for cutting WT1DepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149212)
Plasmid#77051Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149358)
Plasmid#77052Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmarca4#1/Cre
Plasmid#173619PurposeExpresses a Smarca4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smarca4 (Smarca4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF0917
Plasmid#142198PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgNRF2-4
Plasmid#186839Purposeknock out NRF2 in mammalian cellsDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mAtp6v1a-2
Plasmid#198478Purposelentiviral stable expression of mAtp6v1a gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-mTagBFP2-rMPC1 shRNA
Plasmid#229016PurposeExpression of an shRNA construct that knocks down rat MPC1. This plasmid also encodes a blue fluorescent protein tag to verify transfectionDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_1
Plasmid#232312PurposeMouse Etfdh Gene Knockout (gRNA 1)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3052
Plasmid#144528PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-Flag-HA-FKBP-T(WT)
Plasmid#181734Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiCRISPR v2-sgBAP1-1
Plasmid#125837PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only