We narrowed to 15,964 results for: GRN
-
Plasmid#92395PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.DepositorInsertchick U6.1 promoter and gRNA cloning cassette
UseCRISPRExpressionMammalianPromoterchick U6.1Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-esgRNA
Plasmid#115620PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-gRNA
Plasmid#61089PurposeCRISPR/Cas9 system gRNA cloningDepositorInsertH1 promoter; gRNA sequences
UseCRISPR; /cas9 grna cloning vectorExpressionMammalianPromoterH1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-NG-esgRNA
Plasmid#138136PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-NG-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-gRNA
Plasmid#226867PurposeLentiviral expression of Sp-gRNA with BlpI and BstXI restriction sites for gRNA spacer cloning. Also expresses BFP.DepositorInsertLenti Sp-gRNA
UseLentiviralPromotermU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p276 eSpCas9_2gRNAs_hH11
Plasmid#164850PurposegRNA vector for targeting human H11 locusDepositorInsertgRNAs for targeting human H11 locus
ExpressionMammalianPromoterU6Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MYH11-gRNA1
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMPTY::sgRNA2
Plasmid#165459PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteriaDepositorInsertsgRNA2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterSP01Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-1-esgRNA
Plasmid#138135PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only