We narrowed to 6,228 results for: KIT;
-
Plasmid#178723PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-ChR2-YFP
Plasmid#178724PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-ChR2-YFP
Plasmid#178726PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-V5-APEX2-NES
Plasmid#178700PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-TeTLc-P2A-mCherry
Plasmid#178708PurposeAAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertTeTLc-P2A-mCherry
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-V5-APEX2-NES
Plasmid#178698PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-V5-APEX2-NES
Plasmid#178699PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187951PurposeFKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianPromoterCAGAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Hygro)
Plasmid#158622PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FFSS-BACH1
Plasmid#232273PurposeExpression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
Plasmid#236246PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membraneDepositorInsertgRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only