We narrowed to 17,934 results for: multi
-
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP_sfCherry2(11)_Keratin
Plasmid#82604PurposeExpresses sfCherry2(11) tagged keratin in mammalian cellsDepositorInsertsfCherry2(11)_Keratin
ExpressionMammalianMutationchanged Gly12 to Ala in sfCherry11+Available sinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NESPylRS(AF)_hU6tRNAPyl
Plasmid#223508PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsExpressionMammalianMutationY306A; Y384FPromoterCVM, SP6 and U6Available sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO-pAce-Kv2.1PR
Plasmid#195535PurposeFlp recombinase-dependent green fluorescent, positive response-polarity voltage indicator; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCAGAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBT-PE2-PGK-Blast
Plasmid#173219PurposepiggyBac transposon containing PE2 and Blasticidin expression cassettesDepositorInsertsPE2
Blast
UsePiggybacExpressionMammalianPromoterCMV and hPGKAvailable sinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ePB-Bsd-CAG-LoxP-dsRed_PA-LoxP-SV40-NLS-NG-T2A-MCS:
Plasmid#179585PurposeePiggyBac vector that has a blasticidin selectable cassette and a LoxP exchangeable dual colors cassette (Red module-dsRed/Green module-NeonGreen)DepositorInsertNLS-NG-T2A-hSHH
UsePiggybacTagsNLS-NG-T2APromoterCAGpAvailable sinceFeb. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZR047_Lenti-U6-sgGARP-MS2-PP7-hPGK-PCP-p65-HSF1-Puro
Plasmid#180268PurposeLentiviral expression vector for CRISPRa-SAM with GARP targeting sgRNADepositorInsertGARP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCashGem-Xyl2-URA3-LINEAR
Plasmid#174840PurposepRS414 backbone containing LINEAR fragment targeting XYL2 in S. stipitisDepositorInsertCodon optimized Cas9:hGem
UseCRISPR and Synthetic BiologyTagshGeminin tagExpressionBacterial and YeastPromoterENO1pAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCCM’
Plasmid#162709PurposepCCM reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertSecond CCM operon cloned from H. neapolitanus
ExpressionBacterialMutationp15A origin replaced with high-copy colE1 originPromoterPLtet0-1 promoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUltra-H2B-mTagBFP2
Plasmid#161791Purpose3rd generation lentiviral multicistronic vector for mammalian expression of EGFP, H2B-mTagBFP2, and one gene of interestDepositorInsertH2B-mTagBFP2
UseLentiviral; MulticistronicTagsEGFP and mTagBFP2ExpressionMammalianMutationI174A in the mTagBFP2 protein according to PLoS O…PromoterUbCAvailable sinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAH243
Plasmid#121147PurposeExpression of both nmt41p-cas9 and rrk1p-gRNA (ura4 marker) for CRISPR genome editing in fission yeastDepositorInsertshumanized Streptococcus pyogenes Cas9
gRNA expression module
UseCRISPRTagsFlagExpressionYeastPromoterS.pombe rrk1 and nmt41Available sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
8047_GFP-Kras2B_ires_puro
Plasmid#64371PurposeThis a retroviral expression plasmid expressing GFP tagged wild type Kras 2B oncogene along with puro resistance geneDepositorAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWUR 1+2 tetO mut89
Plasmid#80102PurposeEncodes a set of wild-type Cas1+2 and a mutant set of Cas1+2DepositorPublicationExpressionBacterialMutationQ24H, P202Q, G241D, E276D, L297QAvailable sinceDec. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTriEx-mCherry-Zdk1-Rac1 Q61L
Plasmid#81059Purposemammalian expression of Zdk1 tagged Rac1 Q61LDepositorAvailable sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLAREG
Plasmid#73044PurposeInducible expression of EGFP in yeast. Has dual-mode promoter with activation and repression capability for tuning gene expression in yeast.DepositorInsertsEGFP
LacI
ExpressionYeastPromoterGAL1 promoter and hybrid dual-mode promoter-see c…Available sinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn2
Plasmid#59358PurposeLentiviral expression vector: Neuroligin 2 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available sinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lentiviral CaMKKbeta
Plasmid#33322DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Mouse)
UseLentiviralTagsFlagPromoterhuman PGKAvailable sinceApril 17, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by