We narrowed to 5,470 results for: crispr cas9 grna plasmid

#199342

encodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherry

David Nemazee

May 22, 2024

Academic Institutions and Nonprofits only

#199343

encodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherry

David Nemazee

May 22, 2024

Academic Institutions and Nonprofits only

#166005

Bacterial expression of dCas9 (aTc control) and sgRNA (arabinose control)

Martin Buck

Bradley et al Biotechnol Rep (Amst). 2021 Oct 9;32:e00

April 27, 2021

Academic Institutions and Nonprofits only

#206935

Expression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.

Markus Grompe

Sept. 14, 2023

Academic Institutions and Nonprofits only

#109219

Episome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutum

Per Winge

Sharma et al Sci Rep. 2018 Sep 26;8(1):14401. doi: 10

June 14, 2018

Academic Institutions and Nonprofits only

#87383

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87386

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only