We narrowed to 11,589 results for: 110
-
Plasmid#110203PurposeRecipient vector for Cranial Neural Crest-specific expression of protein of interestDepositorInsertenhNC1.1_M3-TF_MCS-2A-eGFP-SV40pA
TagseGFPExpressionBacterialAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DYNLL1_Dynein-light
Plasmid#110006PurposeProtein expression and purification of DYNLL1_Dynein-lightDepositorInsertDYNLL1_Dynein-light (DYNLL1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Cry1)-DIO-intron336-dLUC
Plasmid#110056PurposeCry1 transcription luciferase reporterDepositorInsertCry1 promoter and luciferase (Cry1 Mouse)
UseAAV and Cre/LoxExpressionMammalianPromoterCry1Available SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSF-T20S
Plasmid#110805Purposeexpresses Thermoplasma acidophilium 20S proteasome in E. ColiDepositorInsertsPsmB
PsmA
Tagstev-HisExpressionBacterialMutationN2D and Q2EPromoterT7 and T7 promoterAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-BHLHE40
Plasmid#110154PurposeExpression of human BHLHE40 in mammalian cellsDepositorInsertBHLHE40 (basic helix-loop-helix family member e40) (BHLHE40 Human)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458_Ruby
Plasmid#110164PurposeCas9 from S. pyogenes with Ruby2, and cloning backbone for sgRNADepositorInserthSpCas9
UseCRISPRTags3xFLAG and Ruby2ExpressionMammalianAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACEC3GH (Hyg)
Plasmid#110084PurposeReplicative, acetamide-based expression vector containing a C-terminal 3C cleavage site and a GPF-fusion with a His10-tag. Suitable for high-level expression levels amenable for large scale purification of proteins.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM100 (pUC18T-miniTn7T-gm-araC-ParaBAD)
Plasmid#110554PurposeminiTn7 delivery plasmid with araC-ParaBAD inducible promoterDepositorInsertaraC-ParaBAD
ExpressionBacterialPromoterAraC-ParaBADAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-P2A-Puro
Plasmid#110837PurposeLentiviral vector for expression of Cas9 in mammalian cells (codon optimized)DepositorInsertCas9
UseLentiviralMutationWTPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3H
Plasmid#110080PurposeAnalogous to pMINTC3H, but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFLAG_OriM
Plasmid#110097PurposeAnalogous to pFLAG_attP, but containing oriM instead of attP, thus being a replicative vector.DepositorTypeEmpty backboneTags3xFLAGExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFLAG_attP
Plasmid#110095PurposeVector for low-level constitutive expression in mycobacteria from the Tet promoter. Lacks the Tet repressor. Contains attP for chromosomal integration. Lacks the integrase and thus remains stably integrated in the absence of antibiotic selection. Contains a C-terminal 3xFLAG to allow detection of expression levels by Western blotting.DepositorTypeEmpty backboneTags3xFLAGExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-SOX4
Plasmid#110367PurposeMammalian expression of HA-tagged SOX4DepositorAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
MP28444 – pFUSE2ss-aRD114_CHIg-mIgG2A
Plasmid#110555PurposepFUSE backbone with an IL2 signal sequence, expressing the variable heavy chain of anti-RD114 binder fused to murine IgG2A constant heavy chain.DepositorInsertAnti-RD114 heavy chain
TagsmIgG2AExpressionBacterial and MammalianPromoterEF-1 alpha core promoterAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
MP28445 – pFUSE2ss-aRD114_CLIg-mIgK
Plasmid#110556PurposepFUSE backbone with an IL2 signal sequence, expressing the variable light chain of anti-RD114 binder fused to murine Kappa constant light chain.DepositorInsertanit-RD114 light chain
TagsmKappaExpressionBacterial and MammalianPromoterEF-1 alpha core promoterAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
EFS-GFP
Plasmid#110834Purposepositive control for GFP expressionDepositorInsertelongation factor 1alpha binding sequence (EFS) at GFP promoter region
UseLentiviralExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-BLM
Plasmid#110299PurposeMammalian expression of a EGFP-tagged full length Bloom's syndrome helicaseDepositorAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSET-6xTR-TUBE
Plasmid#110313PurposeE. coli expression and purification of 6xTR-TUBEDepositorInsert6xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-URH49 WT
Plasmid#110127PurposeExpresses Flag-tagged human URH49 (DDX39A)DepositorAvailable SinceApril 6, 2019AvailabilityAcademic Institutions and Nonprofits only