We narrowed to 1,634 results for: CAG promoter
-
Plasmid#220560PurposeTo inducibly knockdown WT1 or EWSR1::WT1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pJY-RpABE-PDS3_IMS
Plasmid#112875Purposebinary vector for IMS (Induced Mis-Splicing) of PDS3 in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting PDS3
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti.hUbC.H2B-CeruleanFP-2A-Dendra2FP.W
Plasmid#126522PurposeLentivector that expresses H2B-Cerulean and Dendra2 fluorescent proteins from an internal hUbC promoter.DepositorInsertH2B-CeruleanFP-2A-Dendra2FP
UseLentiviralPromoterhUbCAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Tra].1046D
Plasmid#112693Purposeexpress two gRNA targeting bTub & Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN018
Plasmid#91664PurposeExpress sgRNA targeting human SCN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN272
Plasmid#91643PurposeExpress sgRNA targeting human MMP16DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN017
Plasmid#91663PurposeExpress sgRNA targeting human SCN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
B270 + SPRTN sgSTOP
Plasmid#100718PurposeB270 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-miRFP703-dSal-p53NT(1-97)-S15D-hCRY2-NLS
Plasmid#241842PurposeExpresses an actuator of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCRY2 and miRFP703ExpressionMammalianMutationN-terminus (1-97 aa) containing S15DPromoterCAGGS promoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker-3xFLAG KI
Plasmid#182679PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.DepositorInsertNefl-targeting gRNA and linker-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN151
Plasmid#91680PurposeExpress sgRNA targeting human TSNARE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1277
Plasmid#29140PurposePlasmid described in Yang et al., Genomics, 2009 (PMID: 18950699).DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable SinceSept. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1157
Plasmid#29072PurposePlasmid described in Yang et al., Genomics, 2009 (PMID: 18950699).DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable SinceJan. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1293
Plasmid#29144DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsCreAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1164
Plasmid#29079DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-CreAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1114
Plasmid#29043DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceDec. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1488
Plasmid#29239DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1294
Plasmid#29145DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-B
Plasmid#177785PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO_EGFP-RandE3
Plasmid#79872PurposeFor generating adeno-associated virus to express RandE3 under the EF1a promoter in a 'Cre-on' dependent manner.DepositorInsertGFP-RandE3
UseAAV, Cre/Lox, and Synthetic BiologyTagsGFP and HAExpressionMammalianPromoterEF1aAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
hSyn-PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP
Plasmid#210509Purposeexpresses PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP component in rat hippocampal neuron cellsDepositorInsertsTagsMycExpressionMammalianPromoterhSynAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
UAS:hGCG-ICAM(1235)- Nrxn1b;cryaa:mCherry
Plasmid#218860Purpose10xUAS promoter driving expression of human glucagon-truncated ICAM-zfNrxn1b fusion protein for use in trans-Tango.DepositorInserthGCG-ICAM(1235)-nrxn1b
ExpressionBacterialAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRDM9dC(KRAB-SSXRD-PR/SET-dC)-Cas9
Plasmid#186699PurposePlasmid encoding PRDM9dC-Cas9 fusion under CMV promoterDepositorInsertPRDM9dC(KRAB-SSXRD-PR/SET-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO_EGFP-GFE3
Plasmid#79871PurposeFor generating adeno-associated virus to express GFE3 under the EF1a promoter in a 'Cre-on' dependent manner.DepositorHas ServiceAAV1InsertGFP-GFE3
UseAAV, Cre/Lox, and Synthetic BiologyTagsGFP and HAExpressionMammalianPromoterEF1aAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSuper-PACSIN1-shRNA
Plasmid#72576PurposeExpresses shRNA against PACSIN1DepositorAvailable SinceMay 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNA[bTub+DsxF].1046A
Plasmid#112694Purposeexpress two gRNA targeting bTub & DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA_NUDT5_ex4-EF1α-Cas9-NLS-FLAG-GSG-P2A-PuroR-WPRE
Plasmid#250374PurposeLentiviral expression of sgRNA against human NUDT5 exon 4 under U6 promoter and Cas9-NLS-FLAG-GSG-P2A-PuroR under EF1α core promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9
Plasmid#184464PurposePlasmid encoding PRDM9-Cas9 fusion under CMV promoterDepositorInsertPRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN062
Plasmid#91595PurposeExpress sgRNA targeting human DFNA5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN065
Plasmid#91598PurposeExpress sgRNA targeting human DGKIDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker(A6TAG)-3xFLAG KI
Plasmid#182680PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker(A6TAG)-3xFLAG. Can be used for amber codon suppression and click chemistry labeling of endogenous NFL.DepositorInsertNefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN104
Plasmid#91633PurposeExpress sgRNA targeting human KCTD13DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN086
Plasmid#91611PurposeExpress sgRNA targeting human FESDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN265
Plasmid#91616PurposeExpress sgRNA targeting human FUT9DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN090
Plasmid#91619PurposeExpress sgRNA targeting human GALNT10DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only