We narrowed to 16,142 results for: grn
-
Plasmid#61089PurposeCRISPR/Cas9 system gRNA cloningDepositorInsertH1 promoter; gRNA sequences
UseCRISPR; /cas9 grna cloning vectorExpressionMammalianPromoterH1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-esgRNA
Plasmid#115620PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-gRNA
Plasmid#137776PurposeContains the T7 promoter and gRNA scaffold and is used for the in vitro transcription of gRNAsDepositorInsertgRNA scaffold
UseCRISPRMutationpUC19 BsaI destroyedPromoterT7Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-NG-esgRNA
Plasmid#138136PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-NG-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMPTY::sgRNA2
Plasmid#165459PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteriaDepositorInsertsgRNA2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterSP01Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
HaloKu70 sgRNA
Plasmid#207583PurposesgRNA for the insert of the HaloTag at the endogenous loci of Ku70.DepositorInsertGAGCAGTAGCCAACATGTCA
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcU6_1 sgRNA
Plasmid#92395PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.DepositorInsertchick U6.1 promoter and gRNA cloning cassette
UseCRISPRExpressionMammalianPromoterchick U6.1Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
p276 eSpCas9_2gRNAs_hH11
Plasmid#164850PurposegRNA vector for targeting human H11 locusDepositorInsertgRNAs for targeting human H11 locus
ExpressionMammalianPromoterU6Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MYH11-gRNA1
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-1-esgRNA
Plasmid#138135PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only