We narrowed to 10,546 results for: Uty
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH2charge
Plasmid#105858PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutatnions modify charge of CH2 domain.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3, muatations: Hi…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Progerin-S22D-CS-pLPC
Plasmid#73810PurposeProgerin mutant where Serine 22 is mutated to aspartic acid and where there is a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with substitution of cysteine in CaaX-mo…PromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-S22AProgerin-CS
Plasmid#69063Purposeencodes a Progerin mutant with serine 22 mutated to an alanine and with a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with serine 22 mutated to alanine and wi…PromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
tdEos-EB3-7
Plasmid#57610PurposeLocalization: MT End Binding Protein, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
tdEos-Zyxin-6
Plasmid#57696PurposeLocalization: Focal Adhesions, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
DRH001_scAAV-hSyn-iCre-HA
Plasmid#225086PurposeExpression of iCre with an HA tag in neurons driven by human synapsin promoter.DepositorInsertiCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 CMV 3xFG eIF4G1
Plasmid#158775PurposepcDNA5 transfection plasmid for the exogenous expression of N-terminal 3xFlag-tagged eIF4G1 isoform lacking the microexon.DepositorInserteIF4G1
Tags3xFlagExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2A
Plasmid#224440PurposeRep/Cap plasmid for the production of MyoAAV 2A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDQTTL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-ERK2-MEK1_R4F_coexpression
Plasmid#39212DepositorTagsHis6 and RBSExpressionBacterialMutationMEK1(R4F) = S218E, S222D and deletion of AA32-51PromoterT7 and T7 via RBSAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 CMV 3xFG eIF4G1 +MIC
Plasmid#158776PurposepcDNA5 transfection plasmid for the exogenous expression of N-terminal 3xFlag-tagged eIF4G1 isoform including the microexon.DepositorInserteIF4G1 (with microexon)
Tags3xFlagExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6c-dualU6-Rosa26-twinPE-attB
Plasmid#207861PurposeAAV genome encoding C-terminal PE6c and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PE6c-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
A24M04 mIgM heavy chain-pFEEKW
Plasmid#234809PurposeExpress membrane form of IgM heavy chain containing the VH region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1DepositorInsertA24M04 membrane IgM heavy chain (IGHM Human)
UseLentiviralExpressionBacterial and MammalianPromoterEEK promoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW V5 Eco/Dam mse LaminA
Plasmid#182674PurposeLentiviral eukaryotic expression vector with E.Coli Dam methylation fused to mouse Lamin A. Used in DamID experiments to methylate DNA that interacts in the proximity of Lamin A.DepositorInsertLamin A (Lmna Mouse)
UseLentiviralTagsE. Coli Dam and V5ExpressionMammalianPromoterHSPAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only