We narrowed to 23,593 results for: promoter
-
Plasmid#159394PurposeConstitutive murine mature BDNF expression, controlled under E.coli tac promoterDepositorInsertpr.tac-BDNF (Bdnf, Mouse) (Bdnf Mouse)
UseSynthetic BiologyTagsFLAGExpressionBacterialPromotertac promoterAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-CD8a(7A)
Plasmid#162498PurposeExpresses GFP tagged CD8a mutant in mammalian cells. The seven O-glycosylation sites in its stem region are mutated.DepositorInsertCD8a with a mutated stem region (CD8A Human)
TagsGFPExpressionMammalianMutationThe five threonine and two serine residues are mu…Available SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shNuf2
Plasmid#160961PurposeNuf2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-His-zfKitlga
Plasmid#140292PurposeExpress soluble His-tagged zebrafish Kitlga in insect cellsDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-5U6-sgRNAs-hsyn-EGFP
Plasmid#112213PurposeTargeted DNA methylationDepositorInsertsgRNAs
UseAAVAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM33
Plasmid#154167PurposeAedes aegypti Rel2 (long isoform) with C-terminal IκB domain deleted, expressed under the IE1 promoter and hr5 enhancer from Autographa californica nuclear polyhedris virus.DepositorInsertRel2 (long isoform)
TagsFLAGExpressionInsectMutationC-terminal IκB domain deletedPromoterIE1 promoter and hr5 enhancer from Autographa cal…Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL714
Plasmid#140384PurposeExpresses CtcS-regulated 3WJdB RNA aptamer driven by T7 promoter with the ctcO sequence 5BP downstream from the promoterDepositorInsertT7-ctcO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL710
Plasmid#140380PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 14BP dowsntream from the promoterDepositorInsertT7-14BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL702
Plasmid#140372PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 0BP dowsntream from the promoterDepositorInsertT7-0BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL706
Plasmid#140376PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 6BP dowsntream from the promoterDepositorInsertT7-6BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL707
Plasmid#140377PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 8BP dowsntream from the promoterDepositorInsertT7-8BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL708
Plasmid#140378PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 10BP dowsntream from the promoterDepositorInsertT7-10BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL709
Plasmid#140379PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 12BP dowsntream from the promoterDepositorInsertT7-12BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL720
Plasmid#140390PurposeExpresses QacR-regulated 3WJdB RNA aptamer driven by T7 promoter with the qacO sequence 5BP downstream from the promoterDepositorInsertT7-qacO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL722
Plasmid#140392PurposeExpresses TtgR-regulated 3WJdB RNA aptamer driven by T7 promoter with the ttgO sequence 5BP downstream from the promoterDepositorInsertT7-ttgO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC0.055
Plasmid#119566PurposeLevel 0 part. PromoterDepositorInsertPisiAB
UseSynthetic BiologyMutationbp 391 G to A, RBS* added (22 bp) upstream of ATG…Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2
Plasmid#84719PurposeE. coli RecA promoter followed by stretch with no A's followed by riboswitch for single-round transcriptionDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutation12 nt stretch lacking A's inserted before 5&…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term png in pGEX4
Plasmid#112975PurposeFor protein expression and purification of the C-term of Drosophila pngDepositorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only