We narrowed to 6,127 results for: tTA
-
Plasmid#77404Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-Tet-On-YAP1-shRNA2
Plasmid#176847Purposelentiviral vector for doxycycline-inducible human YAP1 knockdownDepositorInsertYAP1-Sh2 (YAP1 Human)
UseLentiviralAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCRW1
Plasmid#122462PurposeHuman NPM-ALK fusion protein gene in pET28a bacterial expression plasmid. Production of recombinant human NPM-ALK fusion protein in E. coli Bl21 Rosetta2 cellsDepositorTagsHis TagExpressionBacterialPromoterT7lac promoterAvailable SinceMay 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDNA5-FRT/TO-FLAG-TONSL
Plasmid#221011Purposemammalian expression vector of Flag tagged TONSL siRNA resistantDepositorInsertTONSL (TONSL Human)
TagsFlagExpressionMammalianMutationsilent mutations in TONSL: 5’-gaATtAgaTCtaTCGatga…PromoterCMVAvailable SinceJune 24, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_KanR_BastaR_Rb7_GFP
Plasmid#186427Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)DepositorInsertsKanR
BastaR
Rb7
eGFP
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria3-GFP KI
Plasmid#131491PurposeEndogenous tagging of GluA3: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDNA5-FRT/TO-eGFP-TONSL
Plasmid#221012Purposemammalian expression vector of eGFP tagged TONSL siRNA resistantDepositorInsertTONSL (TONSL Human)
TagseGFPExpressionMammalianMutationsilent mutations in TONSL: 5’-gaATtAgaTCtaTCGatga…PromoterCMVAvailable SinceJune 24, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO
Plasmid#52419PurposeConstitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette.DepositorInsertERAS (ERAS Human)
PromoterCAGGSAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
HK1 gRNA (BRDN0001145157)
Plasmid#77643Purpose3rd generation lentiviral gRNA plasmid targeting human HK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-1-EF1a-LibVec
Plasmid#239597Purposeexpresses guide#1 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 UBE2C guide 1
Plasmid#117068Purposesingle guide RNA targeting UBE2C; guide 1DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCM-CLYBL-NGN2-BRN3A
Plasmid#165597PurposeDonor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.DepositorInsertsUseCRISPR and TALENExpressionMammalianPromoterCAG, EF-1alpha, Endogenous CLYBL (splice acceptor…Available SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUt-mPF-BACH1 Cas9-Resistant_AmpR
Plasmid#199221PurposeLPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Positive-Feedback circuit (mPF-BACH1). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertrtTA-Advanced::P2A::EGFP::BACH1 (BACH1 Human)
TagsEGFPExpressionMammalianMutationsilient mutation at nucleic acid 177 C changed to…Promotertight TRE promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only