We narrowed to 14,052 results for: CRISPR-Cas9
-
Plasmid#107024PurposeAAV plasmid expressing Cas9 under control of CMV promoter, by replaceing mecp2 promoter in pX551 from Zhang labDepositorInsertSpCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg1
Plasmid#254529PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg2
Plasmid#254530PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg3
Plasmid#254531PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_ROSA26_sg1
Plasmid#254532PurposeROSA26 control guideDepositorInsertROSA26
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAC152-dual-dCas9VP64-sgExpression
Plasmid#48238PurposeDual expression construct expressing both dCas9VP64 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA Tag, HA-Tag, and VP64ExpressionMammalianMutationD10A;H840AAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAC154-dual-dCas9VP160-sgExpression
Plasmid#48240PurposeDual expression construct expressing both dCas9VP160 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP160ExpressionMammalianMutationD10A H840AAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
hAAVS1-gs4_EF1a-Cas9-2A-GFP
Plasmid#118414PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting AAVS1 locusDepositorAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3'UTR-ST2-com-vector
Plasmid#136269PurposeExpresses SpCas9 and sgRNA ScaffoldDepositorInsertSpCas9 and sgRNA scaffold
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p414-TEF1p-Cas9-CYC1t
Plasmid#43802PurposeA human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the TEF1 promoterDepositorArticleInsertHuman Optimized S. pyogenes Cas9
UseCRISPRExpressionYeastPromoterTEF1 promoterAvailable SinceMarch 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330GFP-hU6-gRNA-hSpCas9
Plasmid#128385PurposeGFP positive gRNA/hSpCas9 constructDepositorInsertGFP, gRNA and hSpCas9
UseCRISPRAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-10xGCN4_Hygro
Plasmid#192651Purpose3rd generation lenti vector encoding dCas9-10xGCN4 (Suntag) with 2A Hygro resistance markerDepositorInsertdCas9-10xGCN4
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p415-GalL-Cas9-CYC1t
Plasmid#43804PurposeA human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the GalL promoterDepositorArticleInsertHuman Optimized S. pyogenes Cas9
UseCRISPRExpressionYeastPromoterGalLAvailable SinceMarch 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1- dCas9-2xNLS-EGFP
Plasmid#74710PurposeExpresses dCas9-2xNLS-EGFP in mammalian cellsDepositorInsertdCas9-2xNLS-EGFP
UseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-dCas9-GFP
Plasmid#64104PurposeExpression of Sp dCas9-GFP in mammalian cellsDepositorInsertSp dCas9
UseCRISPR and LentiviralTagssfGFPExpressionMammalianPromoterEFSAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDL17_Cas9-His Δcys M1C
Plasmid#206251PurposeBacterial expression of SpCas9 Δcys M1C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationM1C, C80S, C574SPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only