-
Plasmid#162708PurposeSecond CCM operon cloned from H. neapolitanus; pFA expressing the remaining 11 genes in the H. neapolitanus CCM clusterDepositorInsertSecond CCM operon cloned from H. neapolitanus
UseTagsExpressionBacterialMutationPromoterPLtet0-1 promoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJB72
Plasmid#226312PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1
UseTagsExpressionBacterialMutationY300APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB44
Plasmid#226303PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S MR1
UseTagsExpressionBacterialMutationC292S, C310SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB43
Plasmid#226302PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertWT CsoS2, frameshift site intact
UseTagsExpressionBacterialMutationPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB67
Plasmid#226316PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with K to A CsoS2 MR1-6
UseTagsExpressionBacterialMutationK261A, K320A, K380A, K436A, K495A, K546APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB68
Plasmid#226315PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-7
UseTagsExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534A, Y585A, Y644APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB74
Plasmid#226314PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-5
UseTagsExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB73
Plasmid#226313PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-3
UseTagsExpressionBacterialMutationY300A, Y359A, Y420APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB51
Plasmid#226308PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1
UseTagsExpressionBacterialMutationVTG273-275AAA, VTG284-286AAA, VTG295-297AAAPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB48
Plasmid#226307PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-6
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB47
Plasmid#226306PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-5
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB46
Plasmid#226305PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-4
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB45
Plasmid#226304PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-2
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB53
Plasmid#226309PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-3
UseTagsExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SLC39A14-GFP
Plasmid#104380PurposeExpresses SLC39A14/ZIP14 wild-type in mammalian cellsDepositorInsertSLC39A14 (SLC39A14 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJB50
Plasmid#226311PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-7
UseTagsExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB55
Plasmid#226310PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-5
UseTagsExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only