We narrowed to 42,050 results for: TRO
-
Plasmid#248526PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA3-1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA5-3
Plasmid#248528PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA5-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA1-4
Plasmid#248523PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA1-4
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA10-3
Plasmid#248536PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA10-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA11-1
Plasmid#248537PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA11-1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA11-2
Plasmid#248538PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA11-2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA12-2
Plasmid#248539PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA12-2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA8-2
Plasmid#248532PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA8-2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA9-1
Plasmid#248533PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA9-1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA9-3
Plasmid#248534PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA9-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA19-3
Plasmid#248547PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA19-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-dCas9
Plasmid#248566PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertdCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationD10A, H840APromoterCMV, TetO2Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-EGFP
Plasmid#237858PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-mcherry
Plasmid#238009PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-RnHFD-4NS-GFP
Plasmid#237432PurposeExpresses Mus musculus CENP-T with rat HFD and 4 mouse-specific residues in positions that show signs of adaptive evolution; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Rattus norvegicus HFD and 4 mouse-specific residues in HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutation432 A to T; 463 T to I, 470 E to L, 485 L to Q in…PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-V561D-V5/HIS
Plasmid#234762PurposeExpression of the V561D mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor and GIST-Plus Syndrome, , constantly activatedDepositorInsertPDGFRA-V561D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationV561D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-R487L-V5/HIS
Plasmid#234761PurposeExpression of the R487L mutant variant of human PDGFRA, which might be associated with Gastrointestinal Stromal TumorDepositorInsertPDGFRA-R487L receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationR487L substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-D842V-V5/HIS
Plasmid#234763PurposeExpression of the D842V mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor, constantly activatedDepositorInsertPDGFRA-D842V receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationD842V substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
HNRNPA1-miRFP670-TRF1
Plasmid#227384PurposeAdhesion module, creates 'seed' at telomereDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only