We narrowed to 9,253 results for: CAG
-
Plasmid#186728PurposeBinary vector for CRISPR/Cas9 (target 1: Mpphot [positive control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-INS-sg
Plasmid#194719PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hINSDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 1
Plasmid#193595PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 1 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 2
Plasmid#193596PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 2 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPGD guide 1
Plasmid#193602PurposePGD knockoutDepositorInsertsgPGD guide 1 (PGD Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 1
Plasmid#193586PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 1 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L1-#2
Plasmid#171504Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L2-#2
Plasmid#171506Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_control_NGFR
Plasmid#189800PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.scr_1
Plasmid#190703PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertScrambled sgRNA 1
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-RARa-VP16
Plasmid#185561PurposeDoxycycline inducible expression of constitutively active Retinoic Acid Receptor alphaDepositorAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DHFR
Plasmid#183281PurposeAll-in-One CRISPRko system with a guide RNA that targets DHFR geneDepositorInsertDHFR
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056D
Plasmid#183132PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii bTub, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only