We narrowed to 9,829 results for: CAG
-
Plasmid#78049Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK8DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
EXOSC10 gRNA (BRDN0001487044)
Plasmid#77988Purpose3rd generation lentiviral gRNA plasmid targeting human EXOSC10DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1 gRNA (BRDN0001145444)
Plasmid#77995Purpose3rd generation lentiviral gRNA plasmid targeting human ALDH18A1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001146963)
Plasmid#77700Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162291)
Plasmid#77097Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001149318)
Plasmid#77100Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVR1 gRNA (BRDN0001145448)
Plasmid#76757Purpose3rd generation lentiviral gRNA plasmid targeting human ACVR1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 gRNA (BRDN0001146385)
Plasmid#76488Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 gRNA (BRDN0001145828)
Plasmid#76489Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PTK2B gRNA (BRDN0001148298)
Plasmid#76387Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2BDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3CD gRNA (BRDN0001146527)
Plasmid#76164Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CDDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK2 gRNA (BRDN0001145364)
Plasmid#75698Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK8 gRNA (BRDN0001487083)
Plasmid#78047Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK8DepositorAvailable sinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRKAR1A gRNA (BRDN0001146329)
Plasmid#77720Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001147334)
Plasmid#75732Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-beta2 RD-1-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128343PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only