We narrowed to 13,804 results for: TIM
-
Plasmid#145156PurposeMammalian expression plasmid for soluble ACE2 (protease domain) T92Q glycosylation mutantDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationTagsExpressionMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available sinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2 Met133, 138, 186 to Ileu
Plasmid#127269PurposeFor in vitro translation of ELL2 with with internal HA tag and Met133, 138, 186 IleuDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationTagsExpressionMutationMet133, 138, 186 to Ileu HA tag after M186PromoterT7Available sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
Plasmid#127271PurposeFor in vitro translation of human ELL2 with Met133, 138, 186 to Ileu with HA tag after 8th MetDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationTagsExpressionMutationMet133, 138, 186 to Ileu with HA tag after 8th MetPromoterT7Available sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2 M133, 138, 186ILeu
Plasmid#127276PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains middle HA tag that doesn't disrupt functionDepositorInsertELL2 (ELL2 Human)
UseTagsExpressionMammalianMutationM133, 138, 186 to Ileu, HA tag at XbaI after Met …PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
RV-cag-Dio-Kif5c-2A-tdt
Plasmid#87668Purposeretroviral vector, conditional expression membrane Tdtomato and Kif5Cdelta560DepositorInsertKif5C-P2A-mTdt (Kif5c Rat)
UseRetroviralTagspalmitylationExpressionMutationmotor domain aa1-560 present, V40A, E125V (see de…PromoterCAGAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NPR2 gRNA (BRDN0001148355)
Plasmid#77753Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorInsertNPR2 (NPR2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
IPMK gRNA (BRDN0001146121)
Plasmid#78075Purpose3rd generation lentiviral gRNA plasmid targeting human IPMKDepositorInsertIPMK (IPMK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCK gRNA (BRDN0001148859)
Plasmid#78057Purpose3rd generation lentiviral gRNA plasmid targeting human DCKDepositorInsertDCK (DCK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCK gRNA (BRDN0001487070)
Plasmid#78058Purpose3rd generation lentiviral gRNA plasmid targeting human DCKDepositorInsertDCK (DCK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001487098)
Plasmid#78031Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001148014)
Plasmid#78028Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001146579)
Plasmid#78029Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001148653)
Plasmid#78030Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK3 gRNA (BRDN0001487159)
Plasmid#77993Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK3DepositorInsertLMTK3 (LMTK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001146806)
Plasmid#78001Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001145144)
Plasmid#78002Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001144933)
Plasmid#78003Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only