We narrowed to 12,235 results for: Hal
-
Plasmid#129272Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed proteinDepositorInsertNLS-VP16-ZF 43-8-NES
Tags6xHAExpressionYeastPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSK234
Plasmid#131149Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mKate2DepositorTypeEmpty backboneUseGateway destination vectorExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK260
Plasmid#129252Purposedual yTRAP, NM fusion to aTF1 reporting on [PSI+] state with mKate2 reporterDepositorInsertSup35 NM yTRAP sensor reporting on mKate2
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK247
Plasmid#131148Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mNeonGreenDepositorTypeEmpty backboneExpressionYeastPromoterpSUP35, min pCYC1Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK226
Plasmid#129268Purposedual yTRAP, RNQ1 fusion to aTF2 reporting on [RNQ+] state with mNeonGreen reporterDepositorInsertRnq1
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
TRE-mClover3
Plasmid#214922Purposeexpression vector control - contitutive expression of mClover3 aloneDepositorInsertmClover3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MuHKII-pGFPN3
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(Q147L)_g4+g10+g18
Plasmid#172316PurposeCRISPR dCas9 directly fused to a variant of bacterial DNA methyltransferase MQ1 to target CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(Q147L)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNH11 (pmyo-2::Arch(D95N)::2xMycTag)
Plasmid#130275PurposeExpresses the voltage sensor Arch(D95N) in the pharynx of C. elegans.DepositorInsertArch(D95N)
Tags2x Myc-tagExpressionWormAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN201
Plasmid#129204PurposeyTRAP sensor of [RNQ+], detects aggregation of Rnq1DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH13 (pmyo-2::QuasAr::mOrange)
Plasmid#130273PurposeExpresses the eFRET-based voltage sensor QuasAr::mOrange in the pharynx of C. elegans.DepositorInsertQuasAr::mOrange
TagsmOrangeExpressionWormAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN200
Plasmid#129203PurposeyTRAP sensor of [PSI+], detects aggregation of Sup35DepositorInsertSup35NM (SUP35 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationN terminal and middle domainsPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pADH100Cau
Plasmid#244817PurposeModified plasmid from pADH100 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertSNR52p from C. auris
UseCRISPRTagsHIS1 terminator from C. auris and NAT resistance …ExpressionYeastPromoterSNR52pAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPMutationD387APromoterUASAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
ATG-1929
Plasmid#108712PurposeCBR2opt in pF4Ag expression vector with T7 and CMV promoterDepositorInsertCBR2opt
ExpressionBacterial and MammalianMutationPromega used directed evolution to create CBR (Cl…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiPromoterH1Available SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 H2B-GFP-uvr8at(2x)
Plasmid#44970DepositorTagsinternal GFPExpressionMammalianMutationtandem repeat of UVR8 (both have Methionine 1 del…PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
ExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-SRRD-mRuby3
Plasmid#214920Purposeinducible expression of SRRD tagged on C-terminus with mRuby3DepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-noTag (in pLEX_307)
Plasmid#214919Purposeconstitutive expression of SRRD with no tag - used as control for SRRD-HA expressionDepositorInsertSRRD (SRRD Human)
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-HA (in pLEX_307)
Plasmid#214918Purposeconstitutive expression of SRRD tagged with HADepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE071
Plasmid#176828PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert710
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE073
Plasmid#176830PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert712
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE074
Plasmid#176831PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert713
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only