We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#140904PurposeMarkerFree plasmid for integration of pADH1-PCP-Mxi1 into site X-4DepositorInsertPCP-Mxi1
PromoterADH1Available SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJHCi
Plasmid#251729Purposebroad-host-range plasmid for CRISPR interference; inducible dCas9; sgRNA expression from methanotroph constitutive promoterDepositorInsertdCas9
UseCRISPRAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMM765
Plasmid#133602PurposePart Plasmid for dCas9 NLS Stop, Part 3(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM766
Plasmid#133603PurposePart Plasmid for dCas9 NLS Stop, Part 3b(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-SpRY
Plasmid#161520PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zSpRYCas9-NLS without promoterDepositorInsertzSpRYCas9
UseCRISPR; Gateway compatible zsprycas9 entry cloneTags3X FLAG, NLS and NLSExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCRi
Plasmid#207524PurposePlasmid for CRISPRi; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ Sp dCas9, PEM7 →sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→ Sp dCas9, PEM7 →sgRNA; SmR/SpR
UsePseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-EGFP-KASH
Plasmid#154374PurposeVector for Flp-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAVExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
CGBE1-NG (pBM1246)
Plasmid#140256PurposeCMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9_NG-P2A-EGFPDepositorInserteUNG-BE4max(R33A)_NG-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, NG mutations in SpCas9, D10A in…PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
CGBE1-VRQR (pBM1192)
Plasmid#140254PurposeCMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInserteUNG-BE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
SPACE-NG (pRZ5150)
Plasmid#140244PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_NG
ExpressionMammalianMutationV82G in TadA*, NG mutations in SpCas9, D10A in Sp…PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
SPACE-VRQR (pRZ5137)
Plasmid#140245PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_VRQR-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_VRQR
ExpressionMammalianMutationV82G in TadA*, VRQR mutations in SpCas9, D10A in …PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113702PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV, CRISPR, and Mouse TargetingTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only