We narrowed to 14,706 results for: EGF
-
Plasmid#13608DepositorInsertintegrin alpha 9 / alpha 5 (ITGA9 Human)
UseRetroviralTagsGFPExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKIIa(0.4)-stChrimsonR-EGFP-P2A-PdCO-WPRE
Plasmid#202198PurposeExpresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the optimized PdCO under control of minimal CamKIIa promotorDepositorInsertstChrimsonR, PdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_Dual-GST-TEV-SINTBAD-EGFP (codon optimized Sf9)
Plasmid#198035PurposeUsed for the expression and purification of EGFP labelled SINTBAD (SMC Internal No. 1613)DepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PL452-CLSTN2-LA-p2a-EGFP-hGHpA-PGK-neoR-CLSTN2-RA
Plasmid#191688PurposeFor knocking p2a-EFGP into CLSTN2 locusDepositorInsertCLSTN2 homology arms and p2a-EGFP
ExpressionMammalianMutationWTAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
PL752-OTX2-LA-p2a-EGFPnls-hGHpA-PGK-puroR-OTX2-RA
Plasmid#191690PurposeFor knocking p2a-EGFP into OTX2 locusDepositorInsertOTX2 homology arms and p2a-EGFP
ExpressionMammalianMutationWTAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
4xPylT(AGGA)Ev2 PylS mCherry-P2A-eGFP(AGGA)
Plasmid#174529PurposeDual-fluorescence reporter for quantifying PylT(AGGA)Ev2 decoding efficiencyDepositorInsertsPylS
PylT
TagsFlagExpressionMammalianPromoterU6Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOS010E: Entry vector for: CheRiff-eGFP channelrhodopsin (plasma membrane)
Plasmid#163063PurposeEntry vector for: CheRiff-eGFP channelrhodopsin (plasma membrane)DepositorInsertCheRiff
UseGateway CloningTagseGFPAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118163PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa2-EGFP
Plasmid#254429PurposeFor production of AAV containing EGFPDepositorInsertGreen Fluorescent Protein
UseAAVPromoterGfa2Available SinceMay 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_PA-mEGFP-Tau
Plasmid#255810Purposemammalian expression of Tau tagged with PA and mEGFPDepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAVS-EGFP^PTC-35
Plasmid#254990PurposeExpress EGFP^PTC-35 in mammalian cellsDepositorInsertEGFP^PTC-35
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
tetOFF-EGFP^PTC-35
Plasmid#254992PurposeExpress doxycycline-repressive EGFP^PTC-35 in mammalian cellsDepositorInsertEGFP^PTC-35
ExpressionMammalianMutationNAAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PolB (pc2455)
Plasmid#247055PurposeExpresses GFP-tagged human PolB1 in mammalian cellsDepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pN1_FV-NUP62-EGFP3
Plasmid#252747PurposeExpression of NUP62 with three tandem EGFPs. FV is a modified FKBP domain (aka DmrB) whose dimerization is induced by addition of Rapalog2. Blocks nulcear pore in absence of Rapalog2.DepositorAvailable SinceApril 3, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
ER-EGFP-FLAG-APEX2
Plasmid#251714PurposeExpresses ER localized EGFP-FLAG-APEX2 in mammalian cellsDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hVEGFR3-mTurquoise
Plasmid#250335PurposeExpression of the human VEGFR3 tagged with C-terminal mTurquoise tagDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pN1_Rev-GR(m10)-EGFP
Plasmid#252751PurposeControl for studying nuclear export. Expression of a fusion protein containing full-length Rev, the hormone-responsive element of the rat Gr, and GFP. The m10 mutation abolishes nuclear export.DepositorInsertHIV-1 Rev and Glucocorticoid Receptor (GR)
TagsEGFPExpressionMammalianMutationm10 is mutation of nuclear export sequenceAvailable SinceMarch 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-eGFP-T7
Plasmid#242778PurposeAAV transfer plasmid expressing eGFP-T7 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsT7PromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/Integrin-b3-Halo
Plasmid#249172PurposeMammalian expression vector of human ITGB3 fused with Halo-tagDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only