We narrowed to 8,284 results for: crispr grnas
-
Plasmid#242159PurposeEmpty lentiviral backbone for generation of ClonMapper Duo Green (H2B-GFP) gRNA barcode library for use with polyA capture or gRNA capture scRNA-seq technologiesDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
CMDuoRed_Crop-Seq-H2B-mCherry-WPRE-TS-hU6-BsmbI
Plasmid#242160PurposeEmpty lentiviral backbone for generation of ClonMapper Duo Red (H2B-mCherry) gRNA barcode library for use with polyA capture or gRNA capture scRNA-seq technologiesDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE391
Plasmid#149281PurposeT-DNA encoding TRV2 with FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_FT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
p104_gRNA_Sp_CD3e
Plasmid#213780PurposeExpresses CRISPRi gRNA for CD3e promoter and GFP. gRNA driven by mU6.DepositorInsertSp gRNA
UseCRISPR and LentiviralAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-backbone
Plasmid#172517PurposeYeast plasmid encoding a 2-kb gRNA-placeholder flanked by BsmBI/Esp3I restriction sites to facilitate gRNA insertionDepositorInsertgRNA cassette
UseCRISPRExpressionYeastPromoterSNR52Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWS3806
Plasmid#185747PurposeSub-array spacer 2/4DepositorInsertCRISPRai sub-array spacer 2/4
UseCRISPRAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWS3808
Plasmid#185749PurposeSub-array spacer 4/4DepositorInsertCRISPRai sub-array spacer 4/4
UseCRISPRAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133C2.0
Plasmid#99893PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
HH-gRNA-HDV-Shuttle-Vector
Plasmid#169098PurposeBackbone plasmid to generate HH-gRNA-HDV segmentDepositorInsertHH-gRNAbackbone-HDV
ExpressionMammalianPromoterNAAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
JME4393
Plasmid#129657PurposeLYS5ex_CrisprCas9-yl_RFP: CAS9 vector with LYS5ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBFC0619
Plasmid#186690PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_2xBsaI_NT (Guide Stuffer) crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEC581
Plasmid#174369PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.DepositorInsertRFP with PAM rich sequence upstream promoter
UseSynthetic BiologyExpressionBacterialPromoterJ23117Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only