We narrowed to 14,047 results for: crispr grnas
-
Plasmid#184726PurposeEP4-KO in MDCKDepositorInsertA gRNA targeting the dog EP4 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SCAF4_CRISPR resistant
Plasmid#122465PurposepDONR for Gateway cloningDepositorInsertSCAF4 CRISPR resistant (SCAF4 Human)
UseGateway cloningMutationSynonymous mutations conferring resistance to gRN…Available SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
p8266 LentiCRISPR v2 hygro sgNT-1
Plasmid#193977PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8267 LentiCRISPR v2 hygro sgNT-2
Plasmid#193978PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
msFam160b1 (msFHIP2A) g1 lentiCRISPRv2-mCherry
Plasmid#218654PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
msFam160b1 (msFHIP2A) g2 lentiCRISPRv2 mCherry
Plasmid#218655PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEKHA3 (FAPP1) g2 lentiCRISPRv2-opti
Plasmid#218657PurposeKnockout vector for human PLEKHA3 (FAPP1)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEKHA3 (FAPP1) g1 lentiCRISPRv2-opti
Plasmid#218656PurposeKnockout vector for human PLEKHA3 (FAPP1)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-EGFP
Plasmid#75159PurposeDerived from LentiCRISPR v1 but expresses EGFP instead of puromycin resistanceDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEGFPExpressionMammalianAvailable SinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgControl
Plasmid#230080PurposeCrispr knock out controlDepositorInsertnon-specific sequence control
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
All_in_one_CRISPR/Cas9_LacZ
Plasmid#74293Purpose"All-in-one" CRISPR/Cas9 (wt) plasmid for cloning of custom gRNA with blue/white screeningDepositorInsertsLacZ-alpha
Cas9
mCherry
UseCRISPRTagsHAExpressionBacterial and MammalianPromoterLac promoter, SV40, and T7 promoterAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_hMSH2
Plasmid#186155PurposesgRNA targeting human MSH2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCRISPR-CMV
Plasmid#102609PurposeControl lentivector expressing Cas9 and gRNA scaffoldDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMPC2_7
Plasmid#163457Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 7 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only