We narrowed to 14,501 results for: SHR
-
Plasmid#162127PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSMP-RING1_2
Plasmid#36356DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pU6-Decoy
Plasmid#80324PurposeEncodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondiiDepositorInsertDecoy sgRNA
UseCRISPRPromoterU6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1A-BRD3R
Plasmid#130696PurposeLentiviral plasmids encoding human BRD3RDepositorInsertHuman BRD3R (BRD3 Human)
UseLentiviralAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2
Plasmid#70658PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-G9A_1
Plasmid#36395DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRDA_836
Plasmid#216088PurposeCas9 [Sp] knockout targeting CD55, positive controlDepositorInsertCD55 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_mup53_Ex4
Plasmid#85534PurposeInducible expression of guide RNA (mup53_Ex4) with fluorescent GFP reporterDepositorInsertmu p53
PromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-1
Plasmid#74960PurposeCas9 + sgGFP-1 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9-sgMIB1
Plasmid#140239PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a gRNA targeting human MIB1DepositorInsertsgRNA targeting human MIB1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER IKKbeta
Plasmid#26209DepositorInsertpSUPER IKK beta (IKBKB Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE491
Plasmid#149292PurposeT-DNA encoding TRV2 with tRNA multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_tRNA_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-tdTomato
Plasmid#106949PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with tdTomato markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTC364
Plasmid#91213Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, Csy4 processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER IKKalpha
Plasmid#26208DepositorInsertpSUPER IKK alpha (CHUK Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only