We narrowed to 9,742 results for: Tec;
-
Plasmid#202076PurposeBacterial expression of 2A protease from coxsackievirus B3 (CVB3). Contains C-terminal His6-tag.DepositorInsertCVB3 2A protease with HisTag
Tags6xHis-tagExpressionBacterial, Insect, and Mamm…Promoterpolh, CAG, T7Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIPK3[V458A][Q459A][V460A][G461A]-FLAG
Plasmid#199328Purposemutated RHIM motive (interaction inhibited)DepositorInsertReceptor-interacting serine/threonine-protein kinase 3 (RIPK3 Human)
TagsFLAGExpressionMammalianMutationchanged V458, Q459,V460 and G461 to alanineAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268A/270A
Plasmid#199608PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270A for expression in mammalian cells.DepositorAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1026-Tier1-PhCMV-3xNLS-iRFP670
Plasmid#169532PurposeTier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA).DepositorInsertPCMV-driven nucleus-localized far-red fluorescent protein iRFP670
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP
Plasmid#183926PurposeOptogenetic PHR domain coupled to GFP; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA K162M-mTurq2
Plasmid#157773PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and superYFPExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-EKAR-EV
Plasmid#123341PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertmCherry-mCherry-FLARE-EKAR-EV
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Opie2-NeoR[traF]+Opie2-PuroR[dsxM]
Plasmid#131618PurposeExpresses a functional NeoR only in females, a functional PuroR only in males, and dsRed in both genders.DepositorInsertsPuroR[dsxM]
NeoR[traF]
ExpressionInsectPromoterOpie2Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD
Plasmid#113954Purposemammalian expression plasmid for FLAG-tagged human T1R2 extracellular domain with signal peptide of influenza hemagglutininDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-568PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha Ba-crystallin 3kb promoter/AcGFP
Plasmid#98097PurposeaBA-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha Ba-crystallin promoter 3 kb fragment, Danio rerio (cryaba Zebrafish)
UseGfp expressingTagsGFPPromoterDanio alpha Ba-crystallin 3 kb fragment (-3000/-1)Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PH-SWAP70(R223E, R224E)
Plasmid#84583PurposeExpresses GFP-tagged PH-domain of SWAP70 in mammalian cells, impaired phosphoinositide bindingDepositorInsertSWAP70 residues 209-306 with mutations R223E and R224E (SWAP70 Human)
TagsEGFPExpressionMammalianMutationPleckstrin-homology domain, residues 209-306, mut…PromoterCMVAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/S647A
Plasmid#74938PurposeMammalian expression of human NSF mutant S647A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationS647A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only