We narrowed to 8,284 results for: crispr grnas
-
Plasmid#216422PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only
-
L2_lacZgRNA-Cas9-CsA
Plasmid#136138PurposePlasmid to accept gRNA target with SapI, lacZ blue-white screening. Contains Cas9 and HygR.DepositorInsertp5-35Sx2:HygR p5-MpU6:lacZgRNA p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_10A
Plasmid#91207PurposeDirect Cloning, Type: non-T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: noneDepositorInsert35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXJ220-pAAV-PB3'IR-U6-gRNA-EF1a-GFP-KASH-PB5'IR
Plasmid#213481PurposeAAV piggybac transposon vector, with GFP-KASH reporter and gRNA cloning site. Compatible with 10X 5' gRNA capture technology.DepositorInsertsGFP-KASH
U6-gRNA
UseAAVExpressionMammalianAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCR5_gRNA_pX459
Plasmid#192268PurposegRNA expression for CRISPR Genome Editing of CCR5DepositorInsertCCR5 guide RNA
UseCRISPRExpressionMammalianAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
GST-beta catenin tag
Plasmid#186422PurposeEncodes GST fused to beta catenin tag recognized by anti-beta catenin nanobodyDepositorInsertGST-beta catenin tag
Tags6His and GST-beta catenin tag (PDRKAAVSHWQQRS)ExpressionBacterialAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_886
Plasmid#201162PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' VP64 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p1300-dCas9-HV5
Plasmid#239479PurposeAn intermediate vector is used to assemble three gRNAs via Golden Gate cloning.DepositorInsertUBQ-dCAS9
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 2
Plasmid#192365PurposetRNA sequence provider (for checkpoint library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 2
Plasmid#192366PurposetRNA sequence provider (for checkpoint library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gln-tRNA-gRNA scaffold for library 1&2
Plasmid#192367PurposetRNA sequence provider (for checkpoint and immune library)DepositorInsertGln tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 1
Plasmid#192368PurposetRNA sequence provider (for immune library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 1
Plasmid#192369PurposetRNA sequence provider (for immune library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only