We narrowed to 10,285 results for: AGA
-
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin G
Plasmid#68817PurposeGeph G domain expression in mamalian cellsDepositorInsertGephyrin (Gphn Rat)
UseTags3xFLAGExpressionMammalianMutationNILPromoterCMVAvailable sinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorInsertSMO (SMO Human)
UseTagsStreptag-II, HRV 3C siteExpressionMammalianMutationPromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
UseTagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…PromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvFLAG
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa mouse (Dgka Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorInsertCAPRIN1 shRNA (CAPRIN1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAExpressionMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable sinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, CBhAvailable sinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLK2 gRNA (BRDN0001147939)
Plasmid#75617Purpose3rd generation lentiviral gRNA plasmid targeting human TLK2DepositorInsertTLK2 (TLK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
UseTagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin P1
Plasmid#68816PurposeFlag tagged Geph mammalian expressionDepositorInsertGephyrin (Gphn Rat)
UseTags3xFLAGExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only