We narrowed to 8,284 results for: crispr grnas
-
Plasmid#99889PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pET-FLAG-eSpCas9-plus
Plasmid#126774PurposeExpression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2112
Plasmid#91064PurposeModule B, Promoter: PvUbi1, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterPvUbi1Available SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-tagBFP
Plasmid#217007Purposelentiviral plasmid for gRNA cloning with selectable tagBFP expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAIO3
Plasmid#137844PurposeCas9 and gRNA expression plasmid for P. falciparum; no selection in parasites.DepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
Fluorescent reporter for MOBE3-4
Plasmid#219946PurposeMammalian expression of 2x-deadEGFP(A111V/L202S) and aptamer-gRNAs to correct both mutations for MOBE3-4DepositorInsertCMV-EGFP(A111V/L202S); U6-A111V-gRNA-com-3'end; U6-L202S-gRNA-MS2-SL3
UseCRISPRExpressionMammalianMutationEGFP(A111V/L202S)PromoterCMV, U6Available SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS088
Plasmid#211502PurposeAAV genome backbone for AAV-Perturb-seq with direct gRNA capture and nuclei sorting based on eGFP.DepositorTypeEmpty backboneUseAAV, CRISPR, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEE393
Plasmid#149283PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
LCV2_mClover3
Plasmid#155095PurposeLentiviral backbone for cloning and expression of U6 driven gRNAs with Esp3I/BsmBI cloning sites, puromycin selection and mClover3 expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_EGFP
Plasmid#155098PurposeLentiviral backbone for cloning and expression of U6 driven gRNAs with Esp3I/BsmBI cloning sites, puromycin selection and EGFP expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBFC0996
Plasmid#186695PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, 2xLguI cargo stuffer, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
crRNA
Tn7 transposon
2xLguI Cargo Stuffer
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
Plasmid#171099PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB12A
Plasmid#210035PurposeContains cloning site for Cas12a gRNA cassette, inducible Cas12a, rtTA-T2A-puroDepositorInsertsCas12a
rtta-T2A-puro
UseCRISPRTagsnucleoplasmin NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only