4,466 results

#9003

William Sellers

Ramaswamy et al Proc Natl Acad Sci U S A. 1999 Mar 2. 96

Jan. 5, 2006

Academic Institutions and Nonprofits only

#10709

William Sellers

Ramaswamy et al Cancer Cell. 2002 Jul . 2(1):81-91.

Nov. 2, 2005

Academic Institutions and Nonprofits only

#184899

Stable expression of HaloTag7-LC3 in mammalian cells to measure autophagic flux

Noboru Mizushima

Yim et al Elife. 2022 Aug 8;11. pii: 78923. doi: 1

June 14, 2022

Academic Institutions and Nonprofits only

#158079

Expresses SARS-CoV-2 nucleocapsid protein in mammalian cells

Jeremy Luban

Yurkovetskiy et al Cell. 2020 Sep 15. pii: S0092-8674(20)31

Oct. 28, 2020

Academic Institutions and Nonprofits only

#141367

Lentiviral expression of SARS-CoV-2 protein; transient expression and generate lentivirus

Nevan Krogan

Gordon et al Nature. 2020 Jul;583(7816):459-468. doi:

April 8, 2020

Industry, Academic Institutions, and Nonprofits

#138151

For cloning of guide RNAs libraries compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. F overhang aaac. R overhang aaaa

Neville Sanjana

Wessels et al Nat Biotechnol. 2020 Jun;38(6):722-727.

March 4, 2020

Academic Institutions and Nonprofits only

#136035

Scrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#130814

Expresses FKBP-CFAST10 in mammalian cells

Arnaud Gautier

Tebo et al Nat Commun. 2019 Jun 27;10(1):2822. doi:

Sept. 13, 2019

Academic Institutions and Nonprofits only

#129593

The encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mEGFP and His-tag. This plasmid is for bacteria protein expression under T7 promoter and protein purification with HisTrap.

Tim Stasevich

Zhao et al Nat Commun. 2019 Jul 3;10(1):2947. doi:

Aug. 15, 2019

Industry, Academic Institutions, and Nonprofits